Regulon of RbsR2 in Bifidobacterium longum NCC2705

Properties
Regulator type:	Transcription factor
TF locus tag:	BL1768
Regulator family:	LacI
Regulation mode:
Biological process:	Ribonucleoside utilization
Effector:	Ribose
Regulog:	RbsR2 - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By effector - Ribose
By pathway - Ribonucleoside utilization

Regulated operons
	Locus Tag	Name	Function
Position: -109 Score: 6.1 Sequence: TTGGTAAAAGGTTATATCAT Position: -77 Score: 6.5 Sequence: TTGATTAAACGTTTTATCAA Locus tag: BL1769 Name: BL1769 Funciton: Acyl-CoA N-acyltransferase Locus tag: BL1770 Name: rihC Funciton: Non-specific ribonucleoside hydrolase (EC 3.2.-.-) Locus tag: BL1771 Name: rihP Funciton: Predicted ribonucleoside transporter, DcuC family Locus tag: BL1772 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
	BL1769	BL1769	Acyl-CoA N-acyltransferase
	BL1770	rihC	Non-specific ribonucleoside hydrolase (EC 3.2.-.-)
	BL1771	rihP	Predicted ribonucleoside transporter, DcuC family
	BL1772	rbsK	Ribokinase (EC 2.7.1.15)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD