Regulog MsmR1 - Bifidobacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Alpha-galactosides utilization |
| Effector: | Alpha-galactosides |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - LacI
- By effector - Alpha-galactosides
- By pathway - Alpha-galactosides utilization
| Genome | Genes | Operons |
|---|---|---|
| Bifidobacterium longum subsp. infantis ATCC 15697 | 1 | 1 |
| Bifidobacterium adolescentis ATCC 15703 | ||
| Bifidobacterium angulatum DSM 20098 | ||
| Bifidobacterium animalis subsp. lactis AD011 | ||
| Bifidobacterium bifidum NCIMB 41171 | ||
| Bifidobacterium breve DSM 20213 | 1 | 1 |
| Bifidobacterium dentium Bd1 | 5 | 1 |
| Bifidobacterium gallicum DSM 20093 | ||
| Bifidobacterium longum NCC2705 | ||
| Gardnerella vaginalis 409-05 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| agaL1 |
|
|
|
|
|
|
*
Bifidobacterium dentium Bd1 Site: position = -55 score = 5.43079 sequence = GCTTGATAACGTTATCGGGT Site: position = -155 score = 5.18256 sequence = ACGTGAAAACGTTATCGAAG Gene: BDP_0487: Alpha-galactosidase 1 (EC:3.2.1.22) |
|
|
|
Alpha-galactosidase 1 (EC:3.2.1.22) |
| msmE1 |
|
|
|
|
|
|
Gene: BDP_0488: Multiple sugar ABC transporter, substrate-binding protein |
|
|
|
Multiple sugar ABC transporter, substrate-binding protein |
| msmF1 |
|
|
|
|
|
|
Gene: BDP_0489: Multiple sugar ABC transporter, membrane-spanning permease 1 |
|
|
|
Multiple sugar ABC transporter, membrane-spanning permease 1 |
| msmG1 |
|
|
|
|
|
|
Gene: BDP_0491: Multiple sugar ABC transporter, membrane-spanning permease 2 |
|
|
|
Multiple sugar ABC transporter, membrane-spanning permease 2 |
| msmR1 |
*
Bifidobacterium longum subsp. infantis ATCC 15697 Site: position = -210 score = 6.21543 sequence = TTTTGAAACCGGTTTCAGAA Gene: Blon_1483: Transcriptional regulator of alpha-galactoside utilization, LacI family |
|
|
|
|
*
Bifidobacterium breve DSM 20213 Site: position = -181 score = 6.17382 sequence = TTCTGAAACCGGTTTCAGAA Gene: BIFBRE_01266: Transcriptional regulator of alpha-galactoside utilization, LacI family |
Gene: BDP_0492: Transcriptional regulator of alpha-galactoside utilization, LacI family |
|
Gene: BL0838: Transcriptional regulator of alpha-galactoside utilization, LacI family |
|
Transcriptional regulator of alpha-galactoside utilization, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |