Regulon of MsmR1 in Bifidobacterium breve DSM 20213

Properties
Regulator type:	Transcription factor
TF locus tag:	BIFBRE_01266
Regulator family:	LacI
Regulation mode:
Biological process:	Alpha-galactosides utilization
Effector:	Alpha-galactosides
Regulog:	MsmR1 - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By effector - Alpha-galactosides
By pathway - Alpha-galactosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -181 Score: 6.2 Sequence: TTCTGAAACCGGTTTCAGAA Locus tag: BIFBRE_01266 Name: msmR1 Funciton: Transcriptional regulator of alpha-galactoside utilization, LacI family
	BIFBRE_01266	msmR1	Transcriptional regulator of alpha-galactoside utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD