Regulog BDP_2111 - Bifidobacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Carbohydrate metabolism |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - LacI
- By pathway - Carbohydrate metabolism
| Genome | Genes | Operons |
|---|---|---|
| Bifidobacterium longum subsp. infantis ATCC 15697 | ||
| Bifidobacterium adolescentis ATCC 15703 | ||
| Bifidobacterium angulatum DSM 20098 | ||
| Bifidobacterium animalis subsp. lactis AD011 | ||
| Bifidobacterium bifidum NCIMB 41171 | ||
| Bifidobacterium breve DSM 20213 | 3 | 1 |
| Bifidobacterium dentium Bd1 | 6 | 2 |
| Bifidobacterium gallicum DSM 20093 | ||
| Bifidobacterium longum NCC2705 | ||
| Gardnerella vaginalis 409-05 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| BDP_2110 |
|
|
|
|
|
|
*
Bifidobacterium dentium Bd1 Site: position = -145 score = 5.73676 sequence = TAATCGAATCGTTGCGATTC Site: position = -265 score = 6.16393 sequence = AAATCGAATCGTTGCGATTA Gene: BDP_2110: ABC-type transport system, substrate-binding protein |
|
|
|
ABC-type transport system, substrate-binding protein |
| BDP_2109 |
|
|
|
|
|
|
Gene: BDP_2109: ABC-type transport system, permease component |
|
|
|
ABC-type transport system, permease component |
| BDP_2108 |
|
|
|
|
|
|
Gene: BDP_2108: ABC-type transport system, permease component |
|
|
|
ABC-type transport system, permease component |
| BDP_2107 |
|
|
|
|
|
|
Gene: BDP_2107: Glycoside hydrolase family 43 |
|
|
|
Glycoside hydrolase family 43 |
| BDP_2106 |
|
|
|
|
|
|
Gene: BDP_2106: Glycosyl hydrolase family 43 |
|
|
|
Glycosyl hydrolase family 43 |
| CRON 2. | |||||||||||
| BDP_2111 |
|
|
|
|
|
Gene: BIFBRE_02138: Transcriptional regulator of carbohydrate utilization, LacI family |
*
Bifidobacterium dentium Bd1 Site: position = -95 score = 6.16393 sequence = TAATCGCAACGATTCGATTT Site: position = -215 score = 5.73676 sequence = GAATCGCAACGATTCGATTA Gene: BDP_2111: Transcriptional regulator of carbohydrate utilization, LacI family |
|
|
|
Transcriptional regulator of carbohydrate utilization, LacI family |
| CRON 3. | |||||||||||
| BIFBRE_02141 |
|
|
|
|
|
*
Bifidobacterium breve DSM 20213 Site: position = -81 score = 6.20787 sequence = TTATCTTAACGATACGATAT Gene: BIFBRE_02141: ABC-type transport system, substrate-binding component |
|
|
|
|
ABC-type transport system, substrate-binding component |
| BIFBRE_02142 |
|
|
|
|
|
Gene: BIFBRE_02142: ABC-type transport system, permease component |
|
|
|
|
ABC-type transport system, permease component |
| BIFBRE_02143 |
|
|
|
|
|
Gene: BIFBRE_02143: ABC-type transport system, permease component |
|
|
|
|
ABC-type transport system, permease component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |