Regulon of BDP_2111 in Bifidobacterium breve DSM 20213

Properties
Regulator type:	Transcription factor
TF locus tag:	BIFBRE_02138
Regulator family:	LacI
Regulation mode:
Biological process:	Carbohydrate metabolism
Effector:
Regulog:	BDP_2111 - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By pathway - Carbohydrate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -81 Score: 6.2 Sequence: TTATCTTAACGATACGATAT Locus tag: BIFBRE_02141 Name: BIFBRE_02141 Funciton: ABC-type transport system, substrate-binding component Locus tag: BIFBRE_02142 Name: BIFBRE_02142 Funciton: ABC-type transport system, permease component Locus tag: BIFBRE_02143 Name: BIFBRE_02143 Funciton: ABC-type transport system, permease component
	BIFBRE_02141	BIFBRE_02141	ABC-type transport system, substrate-binding component
	BIFBRE_02142	BIFBRE_02142	ABC-type transport system, permease component
	BIFBRE_02143	BIFBRE_02143	ABC-type transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD