Regulon of BDP_2111 in Bifidobacterium dentium Bd1

Properties
Regulator type:	Transcription factor
TF locus tag:	BDP_2111
Regulator family:	LacI
Regulation mode:
Biological process:	Carbohydrate metabolism
Effector:
Regulog:	BDP_2111 - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By pathway - Carbohydrate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -215 Score: 5.7 Sequence: GAATCGCAACGATTCGATTA Position: -95 Score: 6.2 Sequence: TAATCGCAACGATTCGATTT Locus tag: BDP_2111 Name: BDP_2111 Funciton: Transcriptional regulator of carbohydrate utilization, LacI family
	BDP_2111	BDP_2111	Transcriptional regulator of carbohydrate utilization, LacI family
Position: -265 Score: 6.2 Sequence: AAATCGAATCGTTGCGATTA Position: -145 Score: 5.7 Sequence: TAATCGAATCGTTGCGATTC Locus tag: BDP_2110 Name: BDP_2110 Funciton: ABC-type transport system, substrate-binding protein Locus tag: BDP_2109 Name: BDP_2109 Funciton: ABC-type transport system, permease component Locus tag: BDP_2108 Name: BDP_2108 Funciton: ABC-type transport system, permease component Locus tag: BDP_2107 Name: BDP_2107 Funciton: Glycoside hydrolase family 43 Locus tag: BDP_2106 Name: BDP_2106 Funciton: Glycosyl hydrolase family 43
	BDP_2110	BDP_2110	ABC-type transport system, substrate-binding protein
	BDP_2109	BDP_2109	ABC-type transport system, permease component
	BDP_2108	BDP_2108	ABC-type transport system, permease component
	BDP_2107	BDP_2107	Glycoside hydrolase family 43
	BDP_2106	BDP_2106	Glycosyl hydrolase family 43

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD