Regulog RspR - Rhodobacterales

Member of regulog collections
- By taxonomy - Rhodobacterales
- By TF family - GntR/Others
- By effector - L-gulonate
- By effector - D-mannonate
- By pathway - L-gulonate utilization
Genome | Genes | Operons |
---|---|---|
Hyphomonas neptunium ATCC 15444 | ||
Jannaschia sp. CCS1 | ||
Loktanella vestfoldensis SKA53 | ||
Oceanicaulis alexandrii HTCC2633 | ||
Oceanicola batsensis HTCC2597 | ||
Oceanicola granulosus HTCC2516 | ||
Paracoccus denitrificans PD1222 | 9 | 1 |
Rhodobacter sphaeroides 2.4.1 | ||
Rhodobacterales bacterium HTCC2654 | ||
Roseobacter sp. MED193 | ||
Roseovarius nubinhibens ISM | ||
Roseovarius sp. 217 | ||
Silicibacter TM1040 | ||
Silicibacter pomeroyi DSS-3 | 6 | 2 |
Sulfitobacter sp. EE-36 |
Genes | Function | |||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
CRON 1. | ||||||||||||||||
rspR |
|
|
|
|
|
|
*
Paracoccus denitrificans PD1222 Site: position = -48 score = 5.76587 sequence = TTTACTAGTATGCAAGTATG Gene: Pden_5067: Transcriptional regulator for L-gulonate utilization, GntR family |
|
|
|
|
|
|
*
Silicibacter pomeroyi DSS-3 Site: position = -47 score = 5.43738 sequence = CCGACTAGTATGGAAGTATG Gene: SPO1722: Transcriptional regulator for L-gulonate utilization, GntR family |
|
Transcriptional regulator for L-gulonate utilization, GntR family |
rspP |
|
|
|
|
|
|
Gene: Pden_5066: L-gulonate/D-mannonate-specific TRAP-type transport system, periplasmic component |
|
|
|
|
|
|
Gene: SPO1721: L-gulonate/D-mannonate-specific TRAP-type transport system, periplasmic component |
|
L-gulonate/D-mannonate-specific TRAP-type transport system, periplasmic component |
rspQ |
|
|
|
|
|
|
Gene: Pden_5065: L-gulonate/D-mannonate-specific TRAP-type transport system, small permease component |
|
|
|
|
|
|
Gene: SPO1720: L-gulonate/D-mannonate-specific TRAP-type transport system, small permease component |
|
L-gulonate/D-mannonate-specific TRAP-type transport system, small permease component |
rspM |
|
|
|
|
|
|
Gene: Pden_5064: L-gulonate/D-mannonate-specific TRAP-type transport system, large permease component |
|
|
|
|
|
|
Gene: SPO1719: L-gulonate/D-mannonate-specific TRAP-type transport system, large permease component |
|
L-gulonate/D-mannonate-specific TRAP-type transport system, large permease component |
rspB |
|
|
|
|
|
|
Gene: Pden_5063: L-gulonate dehydrogenase, COG1063 family |
|
|
|
|
|
|
Gene: SPO2424: L-gulonate dehydrogenase, COG1063 family |
|
L-gulonate dehydrogenase, COG1063 family |
COG1304 |
|
|
|
|
|
|
Gene: Pden_5062: L-lactate dehydrogenase (FMN-dependent) and related alpha-hydroxy acid dehydrogenases |
|
|
|
|
|
|
|
|
L-lactate dehydrogenase (FMN-dependent) and related alpha-hydroxy acid dehydrogenases |
uxuA |
|
|
|
|
|
|
Gene: Pden_5061: Mannonate dehydratase (EC 4.2.1.8) |
|
|
|
|
|
|
*
Silicibacter pomeroyi DSS-3 Site: position = -71 score = 5.43738 sequence = CATACTTCCATACTAGTCGG Gene: SPO1723: Mannonate dehydratase (EC 4.2.1.8) |
|
Mannonate dehydratase (EC 4.2.1.8) |
uxuB |
|
|
|
|
|
|
Gene: Pden_5060: D-mannonate oxidoreductase (EC 1.1.1.57) |
|
|
|
|
|
|
Gene: SPO1724: D-mannonate oxidoreductase (EC 1.1.1.57) |
|
D-mannonate oxidoreductase (EC 1.1.1.57) |
kdgK |
|
|
|
|
|
|
Gene: Pden_5059: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45) |
|
|
|
|
|
|
|
|
2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |