Regulon of RspR in Paracoccus denitrificans PD1222

Properties
Regulator type:	Transcription factor
TF locus tag:
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	L-gulonate utilization
Effector:	L-gulonate; D-mannonate
Regulog:	RspR - Rhodobacterales
Statistics of regulated genes:
- Genes	9
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - GntR/Others
By effector - L-gulonate
By effector - D-mannonate
By pathway - L-gulonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -48 Score: 5.8 Sequence: TTTACTAGTATGCAAGTATG Locus tag: Pden_5067 Name: rspR Funciton: Transcriptional regulator for L-gulonate utilization, GntR family Locus tag: Pden_5066 Name: rspP Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, periplasmic component Locus tag: Pden_5065 Name: rspQ Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, small permease component Locus tag: Pden_5064 Name: rspM Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, large permease component Locus tag: Pden_5063 Name: rspB Funciton: L-gulonate dehydrogenase, COG1063 family Locus tag: Pden_5062 Name: COG1304 Funciton: L-lactate dehydrogenase (FMN-dependent) and related alpha-hydroxy acid dehydrogenases Locus tag: Pden_5061 Name: uxuA Funciton: Mannonate dehydratase (EC 4.2.1.8) Locus tag: Pden_5060 Name: uxuB Funciton: D-mannonate oxidoreductase (EC 1.1.1.57) Locus tag: Pden_5059 Name: kdgK Funciton: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
	Pden_5067	rspR	Transcriptional regulator for L-gulonate utilization, GntR family
	Pden_5066	rspP	L-gulonate/D-mannonate-specific TRAP-type transport system, periplasmic component
	Pden_5065	rspQ	L-gulonate/D-mannonate-specific TRAP-type transport system, small permease component
	Pden_5064	rspM	L-gulonate/D-mannonate-specific TRAP-type transport system, large permease component
	Pden_5063	rspB	L-gulonate dehydrogenase, COG1063 family
	Pden_5062	COG1304	L-lactate dehydrogenase (FMN-dependent) and related alpha-hydroxy acid dehydrogenases
	Pden_5061	uxuA	Mannonate dehydratase (EC 4.2.1.8)
	Pden_5060	uxuB	D-mannonate oxidoreductase (EC 1.1.1.57)
	Pden_5059	kdgK	2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD