Regulon of RspR in Silicibacter pomeroyi DSS-3

Properties
Regulator type:	Transcription factor
TF locus tag:	SPO1722
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	L-gulonate utilization
Effector:	L-gulonate; D-mannonate
Regulog:	RspR - Rhodobacterales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - GntR/Others
By effector - L-gulonate
By effector - D-mannonate
By pathway - L-gulonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -71 Score: 5.4 Sequence: CATACTTCCATACTAGTCGG Locus tag: SPO1723 Name: uxuA Funciton: Mannonate dehydratase (EC 4.2.1.8) Locus tag: SPO1724 Name: uxuB Funciton: D-mannonate oxidoreductase (EC 1.1.1.57)
	SPO1723	uxuA	Mannonate dehydratase (EC 4.2.1.8)
	SPO1724	uxuB	D-mannonate oxidoreductase (EC 1.1.1.57)
Position: -47 Score: 5.4 Sequence: CCGACTAGTATGGAAGTATG Locus tag: SPO1722 Name: rspR Funciton: Transcriptional regulator for L-gulonate utilization, GntR family Locus tag: SPO1721 Name: rspP Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, periplasmic component Locus tag: SPO1720 Name: rspQ Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, small permease component Locus tag: SPO1719 Name: rspM Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, large permease component
	SPO1722	rspR	Transcriptional regulator for L-gulonate utilization, GntR family
	SPO1721	rspP	L-gulonate/D-mannonate-specific TRAP-type transport system, periplasmic component
	SPO1720	rspQ	L-gulonate/D-mannonate-specific TRAP-type transport system, small permease component
	SPO1719	rspM	L-gulonate/D-mannonate-specific TRAP-type transport system, large permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD