Regulog GulR - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | LysR |
| Regulation mode: | |
| Biological process: | Glucarate utilization; Galactarate utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By trascription factor - GulR
- By TF family - LysR
- By pathway - Glucarate utilization
- By pathway - Galactarate utilization
| Genome | Genes | Operons |
|---|---|---|
| Xanthobacter autotrophicus Py2 | ||
| Azorhizobium caulinodans ORS 571 | 5 | 2 |
| Nitrobacter winogradskyi Nb-255 | ||
| Bradyrhizobium sp. BTAi1 | 10 | 5 |
| Bradyrhizobium japonicum USDA 110 | 9 | 5 |
| Rhodopseudomonas palustris CGA009 | ||
| Mesorhizobium sp. BNC1 | ||
| Bartonella quintana str. Toulouse | ||
| Brucella melitensis 16M | ||
| Mesorhizobium loti MAFF303099 | ||
| Agrobacterium tumefaciens str. C58 (Cereon) | ||
| Rhizobium etli CFN 42 | ||
| Rhizobium leguminosarum bv. viciae 3841 | ||
| Rhizobium sp. NGR234 | ||
| Sinorhizobium meliloti 1021 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| gudP |
|
*
Azorhizobium caulinodans ORS 571 Site: position = -304 score = 5.48988 sequence = ATCAATCCAAAAAATGGAATGAT Gene: AZC_2640: D-glucarate permease / D-galactarate permease |
|
*
Bradyrhizobium sp. BTAi1 Site: position = -105 score = 6.18422 sequence = ATCAATCCAATAATTGGATCGAT Gene: BBta_6485: D-glucarate permease / D-galactarate permease |
*
Bradyrhizobium japonicum USDA 110 Site: position = -107 score = 6.08215 sequence = ATCAATCCAAAAACGGCATCGAT Gene: blr5869: D-glucarate permease / D-galactarate permease |
|
|
|
|
|
|
|
|
|
|
D-glucarate permease / D-galactarate permease |
| gulR |
|
Gene: AZC_2639: Predicted glucarate/galactarate utilization regulator, LysR family |
|
*
Bradyrhizobium sp. BTAi1 Site: position = -21 score = 5.08401 sequence = ATCCATGCCGGGGAGGCATCGAT Gene: BBta_6486: Predicted glucarate/galactarate utilization regulator, LysR family |
*
Bradyrhizobium japonicum USDA 110 Site: position = -21 score = 4.97114 sequence = ATTCATCTAAGGCATGTATCGAT Gene: blr5870: Predicted glucarate/galactarate utilization regulator, LysR family |
|
|
|
|
|
|
|
|
|
|
Predicted glucarate/galactarate utilization regulator, LysR family |
| CRON 2. | ||||||||||||||||
| kdgD |
Gene: Xaut_3371: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41) |
*
Azorhizobium caulinodans ORS 571 Site: position = -70 score = 5.4118 sequence = ACTGATCCCAAAAACGCATCGAT Gene: AZC_2638: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41) |
|
*
Bradyrhizobium sp. BTAi1 Site: position = -141 score = 5.22867 sequence = ATTGATACCGACCCAGCATCAAT Gene: BBta_6487: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41) |
*
Bradyrhizobium japonicum USDA 110 Site: position = -128 score = 5.35737 sequence = ATTGATGCTGATTTCGCATCGGT Gene: blr5871: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41) |
|
Gene: Meso_1947: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41) |
|
|
|
Gene: Atu3140: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41) |
Gene: RHE_CH02057: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41) |
Gene: RL2335: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41) |
Gene: NGR_b07750: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41) |
Gene: SMa1440: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41) |
5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41) |
| gudD |
|
|
|
Gene: BBta_6488: Glucarate dehydratase (EC 4.2.1.40) |
Gene: blr5872: Glucarate dehydratase (EC 4.2.1.40) |
|
|
|
|
|
|
|
|
|
|
Glucarate dehydratase (EC 4.2.1.40) |
| kgsD |
|
Gene: AZC_2637: Alpha-ketoglutaric semialdehyde dehydrogenase (EC 1.2.1.26) |
|
Gene: BBta_6489: Alpha-ketoglutaric semialdehyde dehydrogenase (EC 1.2.1.26) |
Gene: blr5873: Alpha-ketoglutaric semialdehyde dehydrogenase (EC 1.2.1.26) |
|
|
|
|
|
|
|
|
|
|
Alpha-ketoglutaric semialdehyde dehydrogenase (EC 1.2.1.26) |
| garD |
|
Gene: AZC_2636: D-galactarate dehydratase (EC 4.2.1.42) |
|
Gene: BBta_6490: D-galactarate dehydratase (EC 4.2.1.42) |
Gene: blr5874: D-galactarate dehydratase (EC 4.2.1.42) |
|
|
|
|
|
|
|
|
|
|
D-galactarate dehydratase (EC 4.2.1.42) |
| CRON 3. | ||||||||||||||||
| uxuF |
|
|
|
*
Bradyrhizobium sp. BTAi1 Site: position = -103 score = 5.94043 sequence = ATCAATACCGATCCTGCATCGAT Gene: BBta_6297: Predicted uronate lactonase, PF10282 family |
*
Bradyrhizobium japonicum USDA 110 Site: position = -42 score = 5.7911 sequence = ACCGATACCATTTCGGCATCGAT Gene: blr0368: Predicted uronate lactonase, PF10282 family |
|
|
|
|
|
|
|
|
|
|
Predicted uronate lactonase, PF10282 family |
| CRON 4. | ||||||||||||||||
| uxuP |
Gene: Xaut_3368: Predicted glucuronate /galacturonate TRAP-type transporter, periplasmic component |
Gene: AZC_3338: Predicted glucuronate /galacturonate TRAP-type transporter, periplasmic component |
|
*
Bradyrhizobium sp. BTAi1 Site: position = -183 score = 6.22088 sequence = ATCGATGCAAGTCTTGCATTGAT Gene: BBta_0128: Predicted glucuronate /galacturonate TRAP-type transporter, periplasmic component |
Gene: bll6058: Predicted glucuronate /galacturonate TRAP-type transporter, periplasmic component |
|
|
|
|
|
Gene: Atu3137: Predicted glucuronate /galacturonate TRAP-type transporter, periplasmic component |
|
Gene: RL4358: Predicted glucuronate /galacturonate TRAP-type transporter, periplasmic component |
|
Gene: SMb21353: Predicted glucuronate /galacturonate TRAP-type transporter, periplasmic component |
Predicted glucuronate /galacturonate TRAP-type transporter, periplasmic component |
| uxuQ |
Gene: Xaut_3367: Predicted glucuronate /galacturonate TRAP-type transporter, small permease component |
Gene: AZC_3337: Predicted glucuronate /galacturonate TRAP-type transporter, small permease component |
|
Gene: BBta_0129: Predicted glucuronate /galacturonate TRAP-type transporter, small permease component |
Gene: bll6057: Predicted glucuronate /galacturonate TRAP-type transporter, small permease component |
|
|
|
|
|
Gene: Atu3136: Predicted glucuronate /galacturonate TRAP-type transporter, small permease component |
|
Gene: RL4359: Predicted glucuronate /galacturonate TRAP-type transporter, small permease component |
|
Gene: SMb21352: Predicted glucuronate /galacturonate TRAP-type transporter, small permease component |
Predicted glucuronate /galacturonate TRAP-type transporter, small permease component |
| uxuM |
Gene: Xaut_3366: Predicted glucuronate /galacturonate TRAP-type transporter, large permease component |
Gene: AZC_3336: Predicted glucuronate /galacturonate TRAP-type transporter, large permease component |
|
Gene: BBta_0130: Predicted glucuronate /galacturonate TRAP-type transporter, large permease component |
Gene: bll6056: Predicted glucuronate /galacturonate TRAP-type transporter, large permease component |
|
|
|
|
|
Gene: Atu3135: Predicted glucuronate /galacturonate TRAP-type transporter, large permease component |
|
Gene: RL4360: Predicted glucuronate /galacturonate TRAP-type transporter, large permease component |
|
Gene: SMb21351: Predicted glucuronate /galacturonate TRAP-type transporter, large permease component |
Predicted glucuronate /galacturonate TRAP-type transporter, large permease component |
| CRON 5. | ||||||||||||||||
| uxuP2 |
|
|
|
|
*
Bradyrhizobium japonicum USDA 110 Site: position = -130 score = 5.73582 sequence = ATCCATACCTGAATTGGATCGAT Site: position = -151 score = 4.80007 sequence = ATCAATCTGCGTTCGGCATTGAT Gene: bll6551: Predicted glucuronate /galacturonate TRAP-type transporter, periplasmic component |
|
|
|
|
|
|
|
|
|
|
Predicted glucuronate /galacturonate TRAP-type transporter, periplasmic component |
| uxuQM2 |
|
|
|
|
Gene: bll6550: Predicted glucuronate /galacturonate TRAP-type transporter, small permease component / large permease component |
|
|
|
|
|
|
|
|
|
|
Predicted glucuronate /galacturonate TRAP-type transporter, small permease component / large permease component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |