Regulog XltR - Shewanellaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Xylitol utilization |
| Effector: | Xylitol |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By TF family - LacI
- By effector - Xylitol
- By pathway - Xylitol utilization
| Genome | Genes | Operons |
|---|---|---|
| Shewanella oneidensis MR-1 | ||
| Shewanella putrefaciens CN-32 | ||
| Shewanella sp W3-18-1 | ||
| Shewanella sp ANA-3 | ||
| Shewanella sp MR-4 | ||
| Shewanella sp MR-7 | ||
| Shewanella baltica OS155 | ||
| Shewanella denitrificans OS217 | ||
| Shewanella frigidimarina NCIMB 400 | ||
| Shewanella amazonensis SB2B | ||
| Shewanella loihica PV-4 | ||
| Shewanella pealeana ATCC 700345 | 6 | 2 |
| Shewanella halifaxensis HAW-EB4 | 6 | 2 |
| Shewanella piezotolerans WP3 | ||
| Shewanella sediminis HAW-EB3 | ||
| Shewanella woodyi ATCC 51908 |
| Genes | Function | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||||
| xltF |
|
|
|
|
|
|
|
|
|
|
|
*
Shewanella pealeana ATCC 700345 Site: position = -42 score = 5.8569 sequence = TAATGACATCGATAACATTG Site: position = -204 score = 6.77856 sequence = AAATGTTATCGATAACATTT Gene: Spea_2286: Xylitol dehydrogenase (EC 1.1.1.9) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -42 score = 6.02264 sequence = TAATGACATCGATAACATAA Site: position = -206 score = 6.28991 sequence = AAATGTTATCGATGTCATTT Gene: Shal_2008: Xylitol dehydrogenase (EC 1.1.1.9) |
|
|
|
Xylitol dehydrogenase (EC 1.1.1.9) |
| xylB |
|
|
|
|
|
|
|
|
|
|
|
Gene: Spea_2285: Xylulose kinase (EC 2.7.1.17) |
Gene: Shal_2009: Xylulose kinase (EC 2.7.1.17) |
|
|
|
Xylulose kinase (EC 2.7.1.17) |
| xltA |
|
|
|
|
|
|
|
|
|
|
|
Gene: Spea_2284: Xylitol ABC transporter, ATP-binding component |
Gene: Shal_2010: Xylitol ABC transporter, ATP-binding component |
|
|
|
Xylitol ABC transporter, ATP-binding component |
| xltB |
|
|
|
|
|
|
|
|
|
|
|
Gene: Spea_2283: Xylitol ABC transporter, permease component |
Gene: Shal_2011: Xylitol ABC transporter, permease component |
|
|
|
Xylitol ABC transporter, permease component |
| xltC |
|
|
|
|
|
|
|
|
|
|
|
Gene: Spea_2282: Xylitol ABC transporter, periplasmic substrate-binding protein |
Gene: Shal_2012: Xylitol ABC transporter, periplasmic substrate-binding protein |
|
|
|
Xylitol ABC transporter, periplasmic substrate-binding protein |
| CRON 2. | |||||||||||||||||
| xltR |
|
|
|
|
|
|
|
|
|
|
|
*
Shewanella pealeana ATCC 700345 Site: position = -147 score = 6.77856 sequence = AAATGTTATCGATAACATTT Site: position = -309 score = 5.8569 sequence = CAATGTTATCGATGTCATTA Gene: Spea_2287: Transcriptional regulator of xylitol utilization, LacI family |
*
Shewanella halifaxensis HAW-EB4 Site: position = -148 score = 6.28991 sequence = AAATGACATCGATAACATTT Site: position = -312 score = 6.02264 sequence = TTATGTTATCGATGTCATTA Gene: Shal_2007: Transcriptional regulator of xylitol utilization, LacI family |
|
|
|
Transcriptional regulator of xylitol utilization, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |