Regulog XltR - Shewanellaceae

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Xylitol utilization
Effector:	Xylitol
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - LacI
By effector - Xylitol
By pathway - Xylitol utilization

Statistics of regulated genes
Genome	Genes	Operons
Shewanella oneidensis MR-1
Shewanella putrefaciens CN-32
Shewanella sp W3-18-1
Shewanella sp ANA-3
Shewanella sp MR-4
Shewanella sp MR-7
Shewanella baltica OS155
Shewanella denitrificans OS217
Shewanella frigidimarina NCIMB 400
Shewanella amazonensis SB2B
Shewanella loihica PV-4
Shewanella pealeana ATCC 700345	6	2
Shewanella halifaxensis HAW-EB4	6	2
Shewanella piezotolerans WP3
Shewanella sediminis HAW-EB3
Shewanella woodyi ATCC 51908

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																	Function

CRON 1.
xltF	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	* Shewanella pealeana ATCC 700345 Site: position = -42 score = 5.8569 sequence = TAATGACATCGATAACATTG Site: position = -204 score = 6.77856 sequence = AAATGTTATCGATAACATTT Gene: Spea_2286: Xylitol dehydrogenase (EC 1.1.1.9)	* Shewanella halifaxensis HAW-EB4 Site: position = -42 score = 6.02264 sequence = TAATGACATCGATAACATAA Site: position = -206 score = 6.28991 sequence = AAATGTTATCGATGTCATTT Gene: Shal_2008: Xylitol dehydrogenase (EC 1.1.1.9)	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	Xylitol dehydrogenase (EC 1.1.1.9)
xylB	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345 Gene: Spea_2285: Xylulose kinase (EC 2.7.1.17)	Shewanella halifaxensis HAW-EB4 Gene: Shal_2009: Xylulose kinase (EC 2.7.1.17)	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	Xylulose kinase (EC 2.7.1.17)
xltA	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345 Gene: Spea_2284: Xylitol ABC transporter, ATP-binding component	Shewanella halifaxensis HAW-EB4 Gene: Shal_2010: Xylitol ABC transporter, ATP-binding component	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	Xylitol ABC transporter, ATP-binding component
xltB	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345 Gene: Spea_2283: Xylitol ABC transporter, permease component	Shewanella halifaxensis HAW-EB4 Gene: Shal_2011: Xylitol ABC transporter, permease component	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	Xylitol ABC transporter, permease component
xltC	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345 Gene: Spea_2282: Xylitol ABC transporter, periplasmic substrate-binding protein	Shewanella halifaxensis HAW-EB4 Gene: Shal_2012: Xylitol ABC transporter, periplasmic substrate-binding protein	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	Xylitol ABC transporter, periplasmic substrate-binding protein

CRON 2.
xltR	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	* Shewanella pealeana ATCC 700345 Site: position = -147 score = 6.77856 sequence = AAATGTTATCGATAACATTT Site: position = -309 score = 5.8569 sequence = CAATGTTATCGATGTCATTA Gene: Spea_2287: Transcriptional regulator of xylitol utilization, LacI family	* Shewanella halifaxensis HAW-EB4 Site: position = -148 score = 6.28991 sequence = AAATGACATCGATAACATTT Site: position = -312 score = 6.02264 sequence = TTATGTTATCGATGTCATTA Gene: Shal_2007: Transcriptional regulator of xylitol utilization, LacI family	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	Transcriptional regulator of xylitol utilization, LacI family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog XltR - Shewanellaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --