Regulon of XltR in Shewanella pealeana ATCC 700345

Properties
Regulator type:	Transcription factor
TF locus tag:	Spea_2287
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Xylitol utilization
Effector:	Xylitol
Regulog:	XltR - Shewanellaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - LacI
By effector - Xylitol
By pathway - Xylitol utilization

Regulated operons
	Locus Tag	Name	Function
Position: -204 Score: 6.8 Sequence: AAATGTTATCGATAACATTT Position: -42 Score: 5.9 Sequence: TAATGACATCGATAACATTG Locus tag: Spea_2286 Name: xltF Funciton: Xylitol dehydrogenase (EC 1.1.1.9) Locus tag: Spea_2285 Name: xylB Funciton: Xylulose kinase (EC 2.7.1.17) Locus tag: Spea_2284 Name: xltA Funciton: Xylitol ABC transporter, ATP-binding component Locus tag: Spea_2283 Name: xltB Funciton: Xylitol ABC transporter, permease component Locus tag: Spea_2282 Name: xltC Funciton: Xylitol ABC transporter, periplasmic substrate-binding protein
	Spea_2286	xltF	Xylitol dehydrogenase (EC 1.1.1.9)
	Spea_2285	xylB	Xylulose kinase (EC 2.7.1.17)
	Spea_2284	xltA	Xylitol ABC transporter, ATP-binding component
	Spea_2283	xltB	Xylitol ABC transporter, permease component
	Spea_2282	xltC	Xylitol ABC transporter, periplasmic substrate-binding protein
Position: -309 Score: 5.9 Sequence: CAATGTTATCGATGTCATTA Position: -147 Score: 6.8 Sequence: AAATGTTATCGATAACATTT Locus tag: Spea_2287 Name: xltR Funciton: Transcriptional regulator of xylitol utilization, LacI family
	Spea_2287	xltR	Transcriptional regulator of xylitol utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD