Regulog SO3627 - Shewanellaceae
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By TF family - TetR
| Genome | Genes | Operons |
|---|---|---|
| Shewanella oneidensis MR-1 | 5 | 2 |
| Shewanella putrefaciens CN-32 | ||
| Shewanella sp W3-18-1 | ||
| Shewanella sp ANA-3 | ||
| Shewanella sp MR-4 | ||
| Shewanella sp MR-7 | ||
| Shewanella baltica OS155 | ||
| Shewanella denitrificans OS217 | ||
| Shewanella frigidimarina NCIMB 400 | ||
| Shewanella amazonensis SB2B | ||
| Shewanella loihica PV-4 | ||
| Shewanella pealeana ATCC 700345 | ||
| Shewanella halifaxensis HAW-EB4 | ||
| Shewanella piezotolerans WP3 | ||
| Shewanella sediminis HAW-EB3 | 5 | 2 |
| Shewanella woodyi ATCC 51908 |
| Genes | Function | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||||
| SO3624 |
*
Shewanella oneidensis MR-1 Site: position = -1477 score = 6.93397 sequence = TTCTTGAGaTACAaCTCAAAAA Gene: SO_3624: Flavocytochrome c flavin subunit |
|
|
|
|
|
|
|
|
|
|
|
|
|
*
Shewanella sediminis HAW-EB3 Site: position = -113 score = 6.97508 sequence = TTCTTGAGGTACACCACAAAAA Gene: Ssed_4178: Flavocytochrome c flavin subunit |
|
Flavocytochrome c flavin subunit |
| SO3623 |
Gene: SO_3623: Flavocytochrome c heme subunit |
|
|
|
|
|
|
|
|
|
|
|
|
|
Gene: Ssed_4179: Flavocytochrome c heme subunit |
|
Flavocytochrome c heme subunit |
| SO3622 |
Gene: SO_3622: conserved domain protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
Gene: Ssed_4180: conserved domain protein |
|
conserved domain protein |
| SO3621 |
Gene: SO_3621: conserved hypothetical protein lipoprotein |
|
|
|
|
|
|
|
|
|
|
|
|
|
Gene: Ssed_4181: conserved hypothetical protein lipoprotein |
|
conserved hypothetical protein lipoprotein |
| CRON 2. | |||||||||||||||||
| SO3627 |
*
Shewanella oneidensis MR-1 Site: position = -99 score = 6.93397 sequence = TTTTTGAGTTGTATCTCAAGAA Gene: SO_3627: Transcriptional regulator, TetR family |
|
|
|
|
|
|
|
|
|
|
|
|
|
*
Shewanella sediminis HAW-EB3 Site: position = -96 score = 6.97508 sequence = TTTTTGTGGTGTACCTCAAGAA Gene: Ssed_4177: Transcriptional regulator, TetR family |
|
Transcriptional regulator, TetR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |