Regulog SO3627 - Shewanellaceae

Properties
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:
Effector:
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR

Statistics of regulated genes
Genome	Genes	Operons
Shewanella oneidensis MR-1	5	2
Shewanella putrefaciens CN-32
Shewanella sp W3-18-1
Shewanella sp ANA-3
Shewanella sp MR-4
Shewanella sp MR-7
Shewanella baltica OS155
Shewanella denitrificans OS217
Shewanella frigidimarina NCIMB 400
Shewanella amazonensis SB2B
Shewanella loihica PV-4
Shewanella pealeana ATCC 700345
Shewanella halifaxensis HAW-EB4
Shewanella piezotolerans WP3
Shewanella sediminis HAW-EB3	5	2
Shewanella woodyi ATCC 51908

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																	Function

CRON 1.
SO3624	* Shewanella oneidensis MR-1 Site: position = -1477 score = 6.93397 sequence = TTCTTGAGaTACAaCTCAAAAA Gene: SO_3624: Flavocytochrome c flavin subunit	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	* Shewanella sediminis HAW-EB3 Site: position = -113 score = 6.97508 sequence = TTCTTGAGGTACACCACAAAAA Gene: Ssed_4178: Flavocytochrome c flavin subunit	Shewanella woodyi ATCC 51908	Flavocytochrome c flavin subunit
SO3623	Shewanella oneidensis MR-1 Gene: SO_3623: Flavocytochrome c heme subunit	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3 Gene: Ssed_4179: Flavocytochrome c heme subunit	Shewanella woodyi ATCC 51908	Flavocytochrome c heme subunit
SO3622	Shewanella oneidensis MR-1 Gene: SO_3622: conserved domain protein	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3 Gene: Ssed_4180: conserved domain protein	Shewanella woodyi ATCC 51908	conserved domain protein
SO3621	Shewanella oneidensis MR-1 Gene: SO_3621: conserved hypothetical protein lipoprotein	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3 Gene: Ssed_4181: conserved hypothetical protein lipoprotein	Shewanella woodyi ATCC 51908	conserved hypothetical protein lipoprotein

CRON 2.
SO3627	* Shewanella oneidensis MR-1 Site: position = -99 score = 6.93397 sequence = TTTTTGAGTTGTATCTCAAGAA Gene: SO_3627: Transcriptional regulator, TetR family	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	* Shewanella sediminis HAW-EB3 Site: position = -96 score = 6.97508 sequence = TTTTTGTGGTGTACCTCAAGAA Gene: Ssed_4177: Transcriptional regulator, TetR family	Shewanella woodyi ATCC 51908	Transcriptional regulator, TetR family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog SO3627 - Shewanellaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --