Regulon of SO3627 in Shewanella oneidensis MR-1

Properties
Regulator type:	Transcription factor
TF locus tag:	SO_3627
Regulator family:	TetR
Regulation mode:	repressor
Biological process:
Effector:
Regulog:	SO3627 - Shewanellaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR

Regulated operons
	Locus Tag	Name	Function
Position: -99 Score: 6.9 Sequence: TTTTTGAGTTGTATCTCAAGAA Locus tag: SO_3627 Name: SO3627 Funciton: Transcriptional regulator, TetR family
	SO_3627	SO3627	Transcriptional regulator, TetR family
Position: -1477 Score: 6.9 Sequence: TTCTTGAGaTACAaCTCAAAAA Locus tag: SO_3624 Name: SO3624 Funciton: Flavocytochrome c flavin subunit Locus tag: SO_3623 Name: null Funciton: Flavocytochrome c heme subunit Locus tag: SO_3622 Name: SO3622 Funciton: conserved domain protein Locus tag: SO_3621 Name: SO3621 Funciton: conserved hypothetical protein lipoprotein
	SO_3624	SO3624	Flavocytochrome c flavin subunit
	SO_3623		Flavocytochrome c heme subunit
	SO_3622	SO3622	conserved domain protein
	SO_3621	SO3621	conserved hypothetical protein lipoprotein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD