Regulog PnuR - Shewanellaceae
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | activator |
| Biological process: | NAD biosynthesis |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By TF family - CRP
- By pathway - NAD biosynthesis
| Genome | Genes | Operons |
|---|---|---|
| Shewanella oneidensis MR-1 | 3 | 1 |
| Shewanella putrefaciens CN-32 | 3 | 1 |
| Shewanella sp W3-18-1 | 3 | 1 |
| Shewanella sp ANA-3 | ||
| Shewanella sp MR-4 | ||
| Shewanella sp MR-7 | ||
| Shewanella baltica OS155 | 2 | 1 |
| Shewanella denitrificans OS217 | ||
| Shewanella frigidimarina NCIMB 400 | ||
| Shewanella amazonensis SB2B | ||
| Shewanella loihica PV-4 | ||
| Shewanella pealeana ATCC 700345 | ||
| Shewanella halifaxensis HAW-EB4 | ||
| Shewanella piezotolerans WP3 | ||
| Shewanella sediminis HAW-EB3 | ||
| Shewanella woodyi ATCC 51908 |
| Genes | Function | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||||
| SO4295 |
*
Shewanella oneidensis MR-1 Site: position = -127 score = 5.37544 sequence = TAGGAGACAAATGTCCTCTG Gene: SO_4295: NAD(P)H oxidoreductase YRKL (EC 1.6.99.-) |
*
Shewanella putrefaciens CN-32 Site: position = -126 score = 5.37544 sequence = TAGGAGACAAATGTCCTCTG Gene: Sputcn32_3486: NAD(P)H oxidoreductase YRKL (EC 1.6.99.-) |
*
Shewanella sp W3-18-1 Site: position = -126 score = 5.37544 sequence = TAGGAGACAAATGTCCTCTG Gene: Sputw3181_0453: NAD(P)H oxidoreductase YRKL (EC 1.6.99.-) |
|
|
|
|
|
|
|
|
Gene: Spea_3404: NAD(P)H oxidoreductase YRKL (EC 1.6.99.-) |
Gene: Shal_3489: NAD(P)H oxidoreductase YRKL (EC 1.6.99.-) |
|
Gene: Ssed_1092: NAD(P)H oxidoreductase YRKL (EC 1.6.99.-) |
|
NAD(P)H oxidoreductase YRKL (EC 1.6.99.-) |
| nupC2 |
Gene: SO_4296: Nucleoside permease NupC |
Gene: Sputcn32_3487: Nucleoside permease NupC |
Gene: Sputw3181_0452: Nucleoside permease NupC |
|
|
|
|
|
|
|
|
Gene: Spea_3405: Nucleoside permease NupC |
Gene: Shal_3490: Nucleoside permease NupC |
|
|
|
Nucleoside permease NupC |
| nmrP |
Gene: SO_4297: N-Ribosylnicotinamide phosphorylase (EC 2.4.2.1), predicted |
Gene: Sputcn32_3488: N-Ribosylnicotinamide phosphorylase (EC 2.4.2.1), predicted |
Gene: Sputw3181_0451: N-Ribosylnicotinamide phosphorylase (EC 2.4.2.1), predicted |
|
|
|
Gene: Sbal_3794: N-Ribosylnicotinamide phosphorylase (EC 2.4.2.1), predicted |
|
|
|
|
|
|
|
Gene: Ssed_3654: N-Ribosylnicotinamide phosphorylase (EC 2.4.2.1), predicted |
|
N-Ribosylnicotinamide phosphorylase (EC 2.4.2.1), predicted |
| pnuC |
|
|
|
|
|
|
*
Shewanella baltica OS155 Site: position = -83 score = 4.46385 sequence = AAAGGGACAAAAGTCCGTTT Gene: Sbal_3795: Ribosyl nicotinamide transporter, PnuC-like |
|
|
|
|
|
|
|
|
|
Ribosyl nicotinamide transporter, PnuC-like |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |