Regulog PnuR - Shewanellaceae

Properties
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator
Biological process:	NAD biosynthesis
Effector:
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - CRP
By pathway - NAD biosynthesis

Statistics of regulated genes
Genome	Genes	Operons
Shewanella oneidensis MR-1	3	1
Shewanella putrefaciens CN-32	3	1
Shewanella sp W3-18-1	3	1
Shewanella sp ANA-3
Shewanella sp MR-4
Shewanella sp MR-7
Shewanella baltica OS155	2	1
Shewanella denitrificans OS217
Shewanella frigidimarina NCIMB 400
Shewanella amazonensis SB2B
Shewanella loihica PV-4
Shewanella pealeana ATCC 700345
Shewanella halifaxensis HAW-EB4
Shewanella piezotolerans WP3
Shewanella sediminis HAW-EB3
Shewanella woodyi ATCC 51908

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																	Function

CRON 1.
SO4295	* Shewanella oneidensis MR-1 Site: position = -127 score = 5.37544 sequence = TAGGAGACAAATGTCCTCTG Gene: SO_4295: NAD(P)H oxidoreductase YRKL (EC 1.6.99.-)	* Shewanella putrefaciens CN-32 Site: position = -126 score = 5.37544 sequence = TAGGAGACAAATGTCCTCTG Gene: Sputcn32_3486: NAD(P)H oxidoreductase YRKL (EC 1.6.99.-)	* Shewanella sp W3-18-1 Site: position = -126 score = 5.37544 sequence = TAGGAGACAAATGTCCTCTG Gene: Sputw3181_0453: NAD(P)H oxidoreductase YRKL (EC 1.6.99.-)	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345 Gene: Spea_3404: NAD(P)H oxidoreductase YRKL (EC 1.6.99.-)	Shewanella halifaxensis HAW-EB4 Gene: Shal_3489: NAD(P)H oxidoreductase YRKL (EC 1.6.99.-)	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3 Gene: Ssed_1092: NAD(P)H oxidoreductase YRKL (EC 1.6.99.-)	Shewanella woodyi ATCC 51908	NAD(P)H oxidoreductase YRKL (EC 1.6.99.-)
nupC2	Shewanella oneidensis MR-1 Gene: SO_4296: Nucleoside permease NupC	Shewanella putrefaciens CN-32 Gene: Sputcn32_3487: Nucleoside permease NupC	Shewanella sp W3-18-1 Gene: Sputw3181_0452: Nucleoside permease NupC	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345 Gene: Spea_3405: Nucleoside permease NupC	Shewanella halifaxensis HAW-EB4 Gene: Shal_3490: Nucleoside permease NupC	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	Nucleoside permease NupC
nmrP	Shewanella oneidensis MR-1 Gene: SO_4297: N-Ribosylnicotinamide phosphorylase (EC 2.4.2.1), predicted	Shewanella putrefaciens CN-32 Gene: Sputcn32_3488: N-Ribosylnicotinamide phosphorylase (EC 2.4.2.1), predicted	Shewanella sp W3-18-1 Gene: Sputw3181_0451: N-Ribosylnicotinamide phosphorylase (EC 2.4.2.1), predicted	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	Shewanella baltica OS155 Gene: Sbal_3794: N-Ribosylnicotinamide phosphorylase (EC 2.4.2.1), predicted	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3 Gene: Ssed_3654: N-Ribosylnicotinamide phosphorylase (EC 2.4.2.1), predicted	Shewanella woodyi ATCC 51908	N-Ribosylnicotinamide phosphorylase (EC 2.4.2.1), predicted
pnuC	Shewanella oneidensis MR-1	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3	Shewanella sp MR-4	Shewanella sp MR-7	* Shewanella baltica OS155 Site: position = -83 score = 4.46385 sequence = AAAGGGACAAAAGTCCGTTT Gene: Sbal_3795: Ribosyl nicotinamide transporter, PnuC-like	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	Ribosyl nicotinamide transporter, PnuC-like

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog PnuR - Shewanellaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --