Regulon of PnuR in Shewanella oneidensis MR-1

Properties
Regulator type:	Transcription factor
TF locus tag:	SO_4298
Regulator family:	CRP
Regulation mode:	activator
Biological process:	NAD biosynthesis
Effector:
Regulog:	PnuR - Shewanellaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - CRP
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -127 Score: 5.4 Sequence: TAGGAGACAAATGTCCTCTG Locus tag: SO_4295 Name: SO4295 Funciton: NAD(P)H oxidoreductase YRKL (EC 1.6.99.-) Locus tag: SO_4296 Name: nupC2 Funciton: Nucleoside permease NupC Locus tag: SO_4297 Name: nmrP Funciton: N-Ribosylnicotinamide phosphorylase (EC 2.4.2.1), predicted
	SO_4295	SO4295	NAD(P)H oxidoreductase YRKL (EC 1.6.99.-)
	SO_4296	nupC2	Nucleoside permease NupC
	SO_4297	nmrP	N-Ribosylnicotinamide phosphorylase (EC 2.4.2.1), predicted

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD