Regulon of PnuR in Shewanella baltica OS155

Properties
Regulator type:	Transcription factor
TF locus tag:	Sbal_3793
Regulator family:	CRP
Regulation mode:	activator
Biological process:	NAD biosynthesis
Effector:
Regulog:	PnuR - Shewanellaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - CRP
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -83 Score: 4.5 Sequence: AAAGGGACAAAAGTCCGTTT Locus tag: Sbal_3795 Name: pnuC Funciton: Ribosyl nicotinamide transporter, PnuC-like Locus tag: Sbal_3794 Name: nmrP Funciton: N-Ribosylnicotinamide phosphorylase (EC 2.4.2.1), predicted
	Sbal_3795	pnuC	Ribosyl nicotinamide transporter, PnuC-like
	Sbal_3794	nmrP	N-Ribosylnicotinamide phosphorylase (EC 2.4.2.1), predicted

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD