Regulog YhcF - Clostridia-2
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Clostridia-2
- By TF family - GntR/Others
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
| Genome | Genes | Operons |
|---|---|---|
| Clostridium bartlettii DSM 16795 | 3 | 1 |
| Clostridium difficile 630 | 10 | 3 |
| Clostridium hiranonis DSM 13275 | 10 | 3 |
| Genes | Function | |||
|---|---|---|---|---|
| CRON 1. | ||||
| yhcF2 |
*
Clostridium bartlettii DSM 16795 Site: position = -41 score = 6.18189 sequence = ATTGTATTAAAGTATTAATACAGT Gene: CLOBAR_01382: Transcriptional regulator, GntR family |
*
Clostridium difficile 630 Site: position = -46 score = 6.41516 sequence = ATTGTATTAACAACTTAATACAAT Gene: CD1617: Transcriptional regulator, GntR family |
*
Clostridium hiranonis DSM 13275 Site: position = -44 score = 6.41516 sequence = ATTGTATTAACAACTTAATACAAT Gene: CLOHIR_00206: Transcriptional regulator, GntR family |
Transcriptional regulator, GntR family |
| yhcG2 |
Gene: CLOBAR_01381: ABC-type multidrug transport system, ATPase component |
Gene: CD1618: ABC-type multidrug transport system, ATPase component |
Gene: CLOHIR_00207: ABC-type multidrug transport system, ATPase component |
ABC-type multidrug transport system, ATPase component |
| yhcI2 |
Gene: CLOBAR_01380: ABC-type multidrug transport system, permease component |
Gene: CD1619: ABC-type multidrug transport system, permease component |
Gene: CLOHIR_00208: ABC-type multidrug transport system, permease component |
ABC-type multidrug transport system, permease component |
| CRON 2. | ||||
| vanZ |
|
*
Clostridium difficile 630 Site: position = -45 score = 6.89845 sequence = ATTGTATTAATAAAATAATACAAT Gene: CD1240: Teicoplanin resistance protein |
*
Clostridium hiranonis DSM 13275 Site: position = -78 score = 6.14335 sequence = AGTGTACTAGTTGTATAATACACT Gene: CLOHIR_00601: Teicoplanin resistance protein |
Teicoplanin resistance protein |
| CRON 3. | ||||
| yhcF |
|
*
Clostridium difficile 630 Site: position = -39 score = 6.17787 sequence = AGTGTACTATCGTATTAATACACT Site: position = -113 score = 5.89536 sequence = AGTGTATTAATCGTATAATACACT Gene: CD1606: Transcriptional regulator, GntR family |
*
Clostridium hiranonis DSM 13275 Site: position = -94 score = 4.80579 sequence = TGTGTACTACACAGATAATACGCT Site: position = -242 score = 5.29158 sequence = GGTGTACTACCATTATAATACAGT Site: position = -40 score = 5.63723 sequence = AGTGTACCACATAAATAGTACACC Gene: CLOHIR_00582: Transcriptional regulator, GntR family |
Transcriptional regulator, GntR family |
| yhcG |
|
Gene: CD1607: ABC-type multidrug transport system, ATPase component |
Gene: CLOHIR_00581: ABC-type multidrug transport system, ATPase component |
ABC-type multidrug transport system, ATPase component |
| yhcI |
|
2
Clostridium difficile 630 Gene: CD1610: ABC-type multidrug transport system, permease component Gene: CD1608: ABC-type multidrug transport system, permease component |
2
Clostridium hiranonis DSM 13275 Gene: CLOHIR_00580: ABC-type multidrug transport system, permease component Gene: CLOHIR_00578: ABC-type multidrug transport system, permease component |
ABC-type multidrug transport system, permease component |
| CD1609 |
|
Gene: CD1609: hypothetical protein |
Gene: CLOHIR_00579: hypothetical protein |
hypothetical protein |
| CD1611 |
|
Gene: CD1611: hypothetical protein |
Gene: CLOHIR_00577: hypothetical protein |
hypothetical protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |