Regulon of YhcF in Clostridium difficile 630

Properties
Regulator type:	Transcription factor
TF locus tag:	CD1617, CD1606
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	YhcF - Clostridia-2
Statistics of regulated genes:
- Genes	10
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-2
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -113 Score: 5.9 Sequence: AGTGTATTAATCGTATAATACACT Position: -39 Score: 6.2 Sequence: AGTGTACTATCGTATTAATACACT Locus tag: CD1606 Name: yhcF2 Funciton: Transcriptional regulator, GntR family Locus tag: CD1607 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: CD1608 Name: yhcI Funciton: ABC-type multidrug transport system, permease component Locus tag: CD1609 Name: null Funciton: hypothetical protein Locus tag: CD1610 Name: yhcI Funciton: ABC-type multidrug transport system, permease component Locus tag: CD1611 Name: null Funciton: hypothetical protein
	CD1606	yhcF2	Transcriptional regulator, GntR family
	CD1607	yhcG	ABC-type multidrug transport system, ATPase component
	CD1608	yhcI	ABC-type multidrug transport system, permease component
	CD1609		hypothetical protein
	CD1610	yhcI	ABC-type multidrug transport system, permease component
	CD1611		hypothetical protein
Position: -46 Score: 6.4 Sequence: ATTGTATTAACAACTTAATACAAT Locus tag: CD1617 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: CD1618 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: CD1619 Name: yhcI Funciton: ABC-type multidrug transport system, permease component
	CD1617	yhcF	Transcriptional regulator, GntR family
	CD1618	yhcG	ABC-type multidrug transport system, ATPase component
	CD1619	yhcI	ABC-type multidrug transport system, permease component
Position: -45 Score: 6.9 Sequence: ATTGTATTAATAAAATAATACAAT Locus tag: CD1240 Name: vanZ Funciton: Teicoplanin resistance protein
	CD1240	vanZ	Teicoplanin resistance protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD