Regulog ModE - Shewanellaceae

Properties
Regulator type:	Transcription factor
Regulator family:	ModE
Regulation mode:	repressor
Biological process:	Molybdopterin biosynthesis; Molybdenum homeostasis
Effector:	Molybdate
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - ModE
By TF family - ModE
By effector - Molybdate
By pathway - Molybdopterin biosynthesis
By pathway - Molybdenum homeostasis

Statistics of regulated genes
Genome	Genes	Operons
Shewanella oneidensis MR-1	4	2
Shewanella putrefaciens CN-32
Shewanella sp W3-18-1
Shewanella sp ANA-3	4	2
Shewanella sp MR-4	4	2
Shewanella sp MR-7	4	2
Shewanella baltica OS155	4	2
Shewanella denitrificans OS217
Shewanella frigidimarina NCIMB 400
Shewanella amazonensis SB2B
Shewanella loihica PV-4
Shewanella pealeana ATCC 700345
Shewanella halifaxensis HAW-EB4
Shewanella piezotolerans WP3
Shewanella sediminis HAW-EB3
Shewanella woodyi ATCC 51908

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																	Function

CRON 1.
modA2	* Shewanella oneidensis MR-1 Site: position = -73 score = 5.92034 sequence = CTCGATATATAGATTGGTATATATCGAT Gene: SO_3863: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	* Shewanella sp ANA-3 Site: position = -52 score = 5.86161 sequence = ACCGATATATAGATTGGTATATAACGAT Gene: Shewana3_0743: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)	* Shewanella sp MR-4 Site: position = -52 score = 6.42934 sequence = ATCGATATATAGATTGGTATATAACGAT Gene: Shewmr4_3195: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)	* Shewanella sp MR-7 Site: position = -52 score = 6.42934 sequence = ATCGATATATAGATTGGTATATAACGAT Gene: Shewmr7_0769: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)	* Shewanella baltica OS155 Site: position = -52 score = 6.42934 sequence = ATCGATATATAGATTGGTATATAACGAT Gene: Sbal_3538: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
modB2	Shewanella oneidensis MR-1 Gene: SO_3864: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3 Gene: Shewana3_0742: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)	Shewanella sp MR-4 Gene: Shewmr4_3196: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)	Shewanella sp MR-7 Gene: Shewmr7_0768: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)	Shewanella baltica OS155 Gene: Sbal_3539: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
modC2	Shewanella oneidensis MR-1 Gene: SO_3865: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	Shewanella sp ANA-3 Gene: Shewana3_0741: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)	Shewanella sp MR-4 Gene: Shewmr4_3197: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)	Shewanella sp MR-7 Gene: Shewmr7_0767: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)	Shewanella baltica OS155 Gene: Sbal_3540: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)

CRON 2.
modE	* Shewanella oneidensis MR-1 Site: position = -178 score = 5.92034 sequence = ATCGATATATACCAATCTATATATCGAG Gene: SO_3862: Molybdate-responsive transcriptional regulator ModE	Shewanella putrefaciens CN-32	Shewanella sp W3-18-1	* Shewanella sp ANA-3 Site: position = -178 score = 5.86161 sequence = ATCGTTATATACCAATCTATATATCGGT Gene: Shewana3_0744: Molybdate-responsive transcriptional regulator ModE	* Shewanella sp MR-4 Site: position = -178 score = 6.42934 sequence = ATCGTTATATACCAATCTATATATCGAT Gene: Shewmr4_3194: Molybdate-responsive transcriptional regulator ModE	* Shewanella sp MR-7 Site: position = -178 score = 6.42934 sequence = ATCGTTATATACCAATCTATATATCGAT Gene: Shewmr7_0770: Molybdate-responsive transcriptional regulator ModE	* Shewanella baltica OS155 Site: position = -446 score = 6.42934 sequence = ATCGTTATATAccaAtcTATATAtCGAT Gene: Sbal_3537: Molybdate-responsive transcriptional regulator ModE	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400	Shewanella amazonensis SB2B	Shewanella loihica PV-4	Shewanella pealeana ATCC 700345	Shewanella halifaxensis HAW-EB4	Shewanella piezotolerans WP3	Shewanella sediminis HAW-EB3	Shewanella woodyi ATCC 51908	Molybdate-responsive transcriptional regulator ModE

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog ModE - Shewanellaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --