Regulon of ModE in Shewanella sp ANA-3

Properties
Regulator type:	Transcription factor
TF locus tag:	Shewana3_0744
Regulator family:	ModE
Regulation mode:	repressor
Biological process:	Molybdopterin biosynthesis; Molybdenum homeostasis
Effector:	Molybdate
Regulog:	ModE - Shewanellaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - ModE
By TF family - ModE
By effector - Molybdate
By pathway - Molybdopterin biosynthesis
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -178 Score: 5.9 Sequence: ATCGTTATATACCAATCTATATATCGGT Locus tag: Shewana3_0744 Name: modE Funciton: Molybdate-responsive transcriptional regulator ModE
	Shewana3_0744	modE	Molybdate-responsive transcriptional regulator ModE
Position: -52 Score: 5.9 Sequence: ACCGATATATAGATTGGTATATAACGAT Locus tag: Shewana3_0743 Name: modA2 Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) Locus tag: Shewana3_0742 Name: modB2 Funciton: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) Locus tag: Shewana3_0741 Name: modC2 Funciton: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
	Shewana3_0743	modA2	Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
	Shewana3_0742	modB2	Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
	Shewana3_0741	modC2	Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD