Regulon of ModE in Shewanella baltica OS155
Regulator type: | Transcription factor |
TF locus tag: | Sbal_3537 |
Regulator family: | ModE |
Regulation mode: | repressor |
Biological process: | Molybdopterin biosynthesis; Molybdenum homeostasis |
Effector: | Molybdate |
Regulog: | ModE - Shewanellaceae |
Statistics of regulated genes: | |
- Genes | 4 |
- Operons | 2 |
Visualization: | |
![]() |
Allows to visualize regulon content in the context of metabolic pathways |

Member of regulog collections
- By taxonomy - Shewanellaceae
- By trascription factor - ModE
- By TF family - ModE
- By effector - Molybdate
- By pathway - Molybdopterin biosynthesis
- By pathway - Molybdenum homeostasis
Locus Tag | Name | Function | |
---|---|---|---|
Position: -52
Score: 6.4 Sequence: ATCGATATATAGATTGGTATATAACGAT
Locus tag: Sbal_3538
Name: modA2 Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Locus tag: Sbal_3539
Name: modB2 Funciton: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
Locus tag: Sbal_3540
Name: modC2 Funciton: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1) |
|||
modA2
|
Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
|
||
modB2
|
Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
|
||
modC2
|
Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
|
||
Position: -446
Score: 6.4 Sequence: ATCGTTATATAccaAtcTATATAtCGAT
Locus tag: Sbal_3537
Name: modE Funciton: Molybdate-responsive transcriptional regulator ModE |
|||
modE
|
Molybdate-responsive transcriptional regulator ModE
|
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |