Regulog NrtR - Sphingobacteria
| Regulator type: | Transcription factor |
| Regulator family: | NrtR |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | Adenosine diphosphate ribose |
| Phylum: | Bacteroidetes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - NrtR
- By taxonomy - Sphingobacteria
- By TF family - NrtR
- By effector - Adenosine diphosphate ribose
- By pathway - NAD biosynthesis
| Genome | Genes | Operons |
|---|---|---|
| Algoriphagus sp. PR1 | ||
| Chitinophaga pinensis DSM 2588 | 2 | 1 |
| Cytophaga hutchinsonii ATCC 33406 | 3 | 1 |
| Dyadobacter fermentans DSM 18053 | ||
| Microscilla marina ATCC 23134 | ||
| Pedobacter heparinus DSM 2366 | ||
| Pedobacter sp. BAL39 | ||
| Salinibacter ruber DSM 13855 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| prs |
|
|
*
Cytophaga hutchinsonii ATCC 33406 Site: position = -52 score = 6.93394 sequence = TTTGCGTAATTTTTACACAAA Site: position = -1 score = 6.78165 sequence = ATTGCGTAATAATTACACAAA Gene: CHU_2422: Ribose-phosphate pyrophosphokinase (EC 2.7.6.1) |
|
|
|
|
|
Ribose-phosphate pyrophosphokinase (EC 2.7.6.1) |
| CHU_2423 |
|
|
Gene: CHU_2423: hypothetical protein |
|
|
|
|
|
hypothetical protein |
| nadV |
|
Gene: Cpin_0607: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12) |
Gene: CHU_2424: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12) |
|
|
|
|
|
Nicotinamide phosphoribosyltransferase (EC 2.4.2.12) |
| PF00293 |
|
*
Chitinophaga pinensis DSM 2588 Site: position = -83 score = 6.63663 sequence = TTTGTGTAAAAATTACGGAAA Site: position = -31 score = 6.62369 sequence = TTTGTGTAACAAATACACAAA Gene: Cpin_0606: NUDIX hydrolase |
|
|
|
|
|
|
NUDIX hydrolase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |