Regulog NrtR - Sphingobacteria

Properties
Regulator type:	Transcription factor
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Phylum:	Bacteroidetes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By trascription factor - NrtR
By taxonomy - Sphingobacteria
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Statistics of regulated genes
Genome	Genes	Operons
Algoriphagus sp. PR1
Chitinophaga pinensis DSM 2588	2	1
Cytophaga hutchinsonii ATCC 33406	3	1
Dyadobacter fermentans DSM 18053
Microscilla marina ATCC 23134
Pedobacter heparinus DSM 2366
Pedobacter sp. BAL39
Salinibacter ruber DSM 13855

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes									Function

CRON 1.
prs	Algoriphagus sp. PR1	Chitinophaga pinensis DSM 2588	* Cytophaga hutchinsonii ATCC 33406 Site: position = -52 score = 6.93394 sequence = TTTGCGTAATTTTTACACAAA Site: position = -1 score = 6.78165 sequence = ATTGCGTAATAATTACACAAA Gene: CHU_2422: Ribose-phosphate pyrophosphokinase (EC 2.7.6.1)	Dyadobacter fermentans DSM 18053	Microscilla marina ATCC 23134	Pedobacter heparinus DSM 2366	Pedobacter sp. BAL39	Salinibacter ruber DSM 13855	Ribose-phosphate pyrophosphokinase (EC 2.7.6.1)
CHU_2423	Algoriphagus sp. PR1	Chitinophaga pinensis DSM 2588	Cytophaga hutchinsonii ATCC 33406 Gene: CHU_2423: hypothetical protein	Dyadobacter fermentans DSM 18053	Microscilla marina ATCC 23134	Pedobacter heparinus DSM 2366	Pedobacter sp. BAL39	Salinibacter ruber DSM 13855	hypothetical protein
nadV	Algoriphagus sp. PR1	Chitinophaga pinensis DSM 2588 Gene: Cpin_0607: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)	Cytophaga hutchinsonii ATCC 33406 Gene: CHU_2424: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)	Dyadobacter fermentans DSM 18053	Microscilla marina ATCC 23134	Pedobacter heparinus DSM 2366	Pedobacter sp. BAL39	Salinibacter ruber DSM 13855	Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)
PF00293	Algoriphagus sp. PR1	* Chitinophaga pinensis DSM 2588 Site: position = -83 score = 6.63663 sequence = TTTGTGTAAAAATTACGGAAA Site: position = -31 score = 6.62369 sequence = TTTGTGTAACAAATACACAAA Gene: Cpin_0606: NUDIX hydrolase	Cytophaga hutchinsonii ATCC 33406	Dyadobacter fermentans DSM 18053	Microscilla marina ATCC 23134	Pedobacter heparinus DSM 2366	Pedobacter sp. BAL39	Salinibacter ruber DSM 13855	NUDIX hydrolase

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog NrtR - Sphingobacteria

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --