Regulon of NrtR in Chitinophaga pinensis DSM 2588

Properties
Regulator type:	Transcription factor
TF locus tag:	Cpin_0602
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Sphingobacteria
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By trascription factor - NrtR
By taxonomy - Sphingobacteria
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -83 Score: 6.6 Sequence: TTTGTGTAAAAATTACGGAAA Position: -31 Score: 6.6 Sequence: TTTGTGTAACAAATACACAAA Locus tag: Cpin_0606 Name: PF00293 Funciton: NUDIX hydrolase Locus tag: Cpin_0607 Name: nadV Funciton: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)
	Cpin_0606	PF00293	NUDIX hydrolase
	Cpin_0607	nadV	Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD