Regulon of NrtR in Cytophaga hutchinsonii ATCC 33406

Properties
Regulator type:	Transcription factor
TF locus tag:	CHU_2421
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Sphingobacteria
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By trascription factor - NrtR
By taxonomy - Sphingobacteria
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -52 Score: 6.9 Sequence: TTTGCGTAATTTTTACACAAA Position: -1 Score: 6.8 Sequence: ATTGCGTAATAATTACACAAA Locus tag: CHU_2422 Name: prs Funciton: Ribose-phosphate pyrophosphokinase (EC 2.7.6.1) Locus tag: CHU_2423 Name: null Funciton: hypothetical protein Locus tag: CHU_2424 Name: nadV Funciton: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)
	CHU_2422	prs	Ribose-phosphate pyrophosphokinase (EC 2.7.6.1)
	CHU_2423		hypothetical protein
	CHU_2424	nadV	Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD