Regulog YhcF2 - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - GntR/Others
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
| Genome | Genes | Operons |
|---|---|---|
| Anoxybacillus flavithermus WK1 | ||
| Bacillus amyloliquefaciens FZB42 | ||
| Bacillus cereus ATCC 14579 | ||
| Bacillus clausii KSM-K16 | 6 | 1 |
| Bacillus halodurans C-125 | 4 | 1 |
| Bacillus licheniformis DSM 13 | ||
| Bacillus pumilus SAFR-032 | ||
| Bacillus subtilis subsp. subtilis str. 168 | ||
| Geobacillus kaustophilus HTA426 | ||
| Oceanobacillus iheyensis HTE831 | 4 | 1 |
| Paenibacillus sp. JDR-2 | 5 | 2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| BH2649 |
|
|
|
*2
Bacillus clausii KSM-K16 Gene: ABC3134: ABC-type multidrug transport system, permease component Site: position = -43 score = 6.0797 sequence = ATGTATGAATCACTTAATACAT Site: position = -75 score = 5.16278 sequence = CTGTATCAAGCATATAGTACAC Gene: ABC3130: ABC-type multidrug transport system, permease component |
Gene: BH2649: ABC-type multidrug transport system, permease component |
|
|
|
|
Gene: OB0515: ABC-type multidrug transport system, permease component |
|
ABC-type multidrug transport system, permease component |
| ABC3131 |
|
|
|
Gene: ABC3131: hypothetical protein |
|
|
|
|
|
|
|
hypothetical protein |
| yhcF2 |
|
|
|
Gene: ABC3132: Transcriptional regulator, GntR family |
*
Bacillus halodurans C-125 Site: position = -105 score = 5.74888 sequence = CTGTATGAACCATATAATACAC Site: position = -78 score = 6.27624 sequence = CTGTATTAAAGGATTAATACGC Site: position = -42 score = 6.45572 sequence = ATGTATTAAGTTGTTAATACAC Gene: BH2647: Transcriptional regulator, GntR family |
|
|
|
|
*
Oceanobacillus iheyensis HTE831 Site: position = -96 score = 6.52796 sequence = GTGTATTAAGCATATAATACAT Site: position = -67 score = 6.60186 sequence = GTGTATTATGTGGTTAATACAC Gene: OB0513: Transcriptional regulator, GntR family |
*
Paenibacillus sp. JDR-2 Site: position = -38 score = 5.84549 sequence = TTGTATTACTGCCATAATACAG Gene: Pjdr2_1895: Transcriptional regulator, GntR family |
Transcriptional regulator, GntR family |
| BH2648 |
|
|
|
Gene: ABC3133: ABC-type multidrug transport system, ATPase component |
Gene: BH2648: ABC-type multidrug transport system, ATPase component |
|
|
|
|
Gene: OB0514: ABC-type multidrug transport system, ATPase component |
|
ABC-type multidrug transport system, ATPase component |
| BH2650 |
|
|
|
Gene: ABC3135: hypothetical protein |
Gene: BH2650: hypothetical protein |
|
|
|
|
Gene: OB0516: hypothetical protein |
|
hypothetical protein |
| CRON 2. | ||||||||||||
| Pjdr2_1896 |
|
|
|
|
|
|
|
|
|
|
*
Paenibacillus sp. JDR-2 Site: position = -35 score = 6.01543 sequence = TTGTATTAGTCGATTAATACAG Gene: Pjdr2_1896: hypothetical protein |
hypothetical protein |
| Pjdr2_1897 |
|
|
|
|
|
|
|
|
|
|
Gene: Pjdr2_1897: hypothetical protein |
hypothetical protein |
| Pjdr2_1898 |
|
|
|
|
|
|
|
|
|
|
Gene: Pjdr2_1898: hypothetical protein |
hypothetical protein |
| Pjdr2_1899 |
|
|
|
|
|
|
|
|
|
|
Gene: Pjdr2_1899: ABC transporter related |
ABC transporter related |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |