Regulon of YhcF2 in Paenibacillus sp. JDR-2

Properties
Regulator type:	Transcription factor
TF locus tag:	Pjdr2_1895
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	YhcF2 - Bacillales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -38 Score: 5.8 Sequence: TTGTATTACTGCCATAATACAG Locus tag: Pjdr2_1895 Name: yhcF2 Funciton: Transcriptional regulator, GntR family
	Pjdr2_1895	yhcF2	Transcriptional regulator, GntR family
Position: -35 Score: 6 Sequence: TTGTATTAGTCGATTAATACAG Locus tag: Pjdr2_1896 Name: null Funciton: hypothetical protein Locus tag: Pjdr2_1897 Name: null Funciton: hypothetical protein Locus tag: Pjdr2_1898 Name: null Funciton: hypothetical protein Locus tag: Pjdr2_1899 Name: null Funciton: ABC transporter related
	Pjdr2_1896		hypothetical protein
	Pjdr2_1897		hypothetical protein
	Pjdr2_1898		hypothetical protein
	Pjdr2_1899		ABC transporter related

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD