Regulon of YhcF2 in Oceanobacillus iheyensis HTE831

Properties
Regulator type:	Transcription factor
TF locus tag:	OB0513
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	YhcF2 - Bacillales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -96 Score: 6.5 Sequence: GTGTATTAAGCATATAATACAT Position: -67 Score: 6.6 Sequence: GTGTATTATGTGGTTAATACAC Locus tag: OB0513 Name: yhcF2 Funciton: Transcriptional regulator, GntR family Locus tag: OB0514 Name: BH2648 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: OB0515 Name: BH2649 Funciton: ABC-type multidrug transport system, permease component Locus tag: OB0516 Name: BH2650 Funciton: hypothetical protein
	OB0513	yhcF2	Transcriptional regulator, GntR family
	OB0514	BH2648	ABC-type multidrug transport system, ATPase component
	OB0515	BH2649	ABC-type multidrug transport system, permease component
	OB0516	BH2650	hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD