Regulog RUMGNA_00848 - Clostridia-3
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Clostridia-3
- By TF family - GntR/Others
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
| Genome | Genes | Operons |
|---|---|---|
| Bacteroides pectinophilus ATCC 43243 | 3 | 1 |
| Blautia hansenii DSM 20583 | ||
| Bryantella formatexigens DSM 14469 | ||
| Clostridiales bacterium 1_7_47_FAA | 3 | 1 |
| Clostridium bolteae ATCC BAA-613 | ||
| Clostridium nexile DSM 1787 | ||
| Clostridium scindens ATCC 35704 | ||
| Dorea formicigenerans ATCC 27755 | ||
| Dorea longicatena DSM 13814 | ||
| Eubacterium eligens ATCC 27750 | 3 | 1 |
| Eubacterium rectale ATCC 33656 | 7 | 2 |
| Roseburia intestinalis L1-82 | ||
| Ruminococcus gnavus ATCC 29149 | 3 | 1 |
| Ruminococcus lactaris ATCC 29176 |
| Genes | Function | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||
| RUMGNA_00848 |
*
Bacteroides pectinophilus ATCC 43243 Site: position = -109 score = 6.34738 sequence = CGTACATACTGTATATAGTGTGTATATACGGATGATGCG Gene: BACPEC_02167: Transcriptional regulator, GntR family |
|
|
*
Clostridiales bacterium 1_7_47_FAA Site: position = -106 score = 5.06239 sequence = CCACATCCCATGTTATATTGTATATATACGATATATACA Site: position = -97 score = 7.45477 sequence = ATGTTATATTGTATATATACGATATATACATTATAACCA Gene: Cbac1_010100016778: Transcriptional regulator, GntR family |
|
|
|
|
|
*
Eubacterium eligens ATCC 27750 Site: position = 2 score = 5.55684 sequence = GGCTCTTATTTTGTATATTTTTAATAAACAGTATATAAC Gene: EUBELI_01751: Transcriptional regulator, GntR family |
*2
Eubacterium rectale ATCC 33656 Site: position = -58 score = 6.99018 sequence = TGTATATAGTGTATATATAACACATAAACAGTTGATAAA Site: position = -67 score = 5.82443 sequence = ACACCATGATGTATATAGTGTATATATAACACATAAACA Gene: EUBREC_2159: Transcriptional regulator, GntR family Site: position = -8 score = 5.59567 sequence = TGAATATAATGTACTTGTACGATAAGTACATTAAAGAAC Site: position = -17 score = 5.32033 sequence = CGTTTGCCTTGAATATAATGTACTTGTACGATAAGTACA Gene: EUBREC_3591: Transcriptional regulator, GntR family |
|
*
Ruminococcus gnavus ATCC 29149 Site: position = -96 score = 6.74622 sequence = TTTACAAACTGTACATATTTGATATTGACAGTAATTACA Gene: RUMGNA_00848: Transcriptional regulator, GntR family |
|
Transcriptional regulator, GntR family |
| BH0652 |
Gene: BACPEC_02168: ABC-type multidrug transport system, ATPase component |
|
|
Gene: Cbac1_010100016773: ABC-type multidrug transport system, ATPase component |
|
|
|
|
|
Gene: EUBELI_01750: ABC-type multidrug transport system, ATPase component |
2
Eubacterium rectale ATCC 33656 Gene: EUBREC_2158: ABC-type multidrug transport system, ATPase component Gene: EUBREC_3590: ABC-type multidrug transport system, ATPase component |
|
Gene: RUMGNA_00847: ABC-type multidrug transport system, ATPase component |
|
ABC-type multidrug transport system, ATPase component |
| BH0653 |
Gene: BACPEC_02169: ABC-type multidrug transport system, permease component |
|
|
Gene: Cbac1_010100016768: ABC-type multidrug transport system, permease component |
|
|
|
|
|
Gene: EUBELI_01749: ABC-type multidrug transport system, permease component |
3
Eubacterium rectale ATCC 33656 Gene: EUBREC_3589: ABC-type multidrug transport system, permease component Gene: EUBREC_2157: ABC-type multidrug transport system, permease component Gene: EUBREC_2156: ABC-type multidrug transport system, permease component |
|
Gene: RUMGNA_00846: ABC-type multidrug transport system, permease component |
|
ABC-type multidrug transport system, permease component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |