Regulon of RUMGNA_00848 in Eubacterium rectale ATCC 33656

Properties
Regulator type:	Transcription factor
TF locus tag:	EUBREC_2159, EUBREC_3591
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	RUMGNA_00848 - Clostridia-3
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -67 Score: 5.8 Sequence: ACACCATGATGTATATAGTGTATATATAACACATAAACA Position: -58 Score: 7 Sequence: TGTATATAGTGTATATATAACACATAAACAGTTGATAAA Locus tag: EUBREC_2159 Name: RUMGNA_00848 Funciton: Transcriptional regulator, GntR family Locus tag: EUBREC_2158 Name: BH0652 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: EUBREC_2157 Name: BH0653 Funciton: ABC-type multidrug transport system, permease component Locus tag: EUBREC_2156 Name: BH0653 Funciton: ABC-type multidrug transport system, permease component
	EUBREC_2159	RUMGNA_00848	Transcriptional regulator, GntR family
	EUBREC_2158	BH0652	ABC-type multidrug transport system, ATPase component
	EUBREC_2157	BH0653	ABC-type multidrug transport system, permease component
	EUBREC_2156	BH0653	ABC-type multidrug transport system, permease component
Position: -17 Score: 5.3 Sequence: CGTTTGCCTTGAATATAATGTACTTGTACGATAAGTACA Position: -8 Score: 5.6 Sequence: TGAATATAATGTACTTGTACGATAAGTACATTAAAGAAC Locus tag: EUBREC_3591 Name: RUMGNA_00848 Funciton: Transcriptional regulator, GntR family Locus tag: EUBREC_3590 Name: BH0652 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: EUBREC_3589 Name: BH0653 Funciton: ABC-type multidrug transport system, permease component
	EUBREC_3591	RUMGNA_00848	Transcriptional regulator, GntR family
	EUBREC_3590	BH0652	ABC-type multidrug transport system, ATPase component
	EUBREC_3589	BH0653	ABC-type multidrug transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD