Regulon of RUMGNA_00848 in Ruminococcus gnavus ATCC 29149

Properties
Regulator type:	Transcription factor
TF locus tag:	RUMGNA_00848
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	RUMGNA_00848 - Clostridia-3
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -96 Score: 6.7 Sequence: TTTACAAACTGTACATATTTGATATTGACAGTAATTACA Locus tag: RUMGNA_00848 Name: RUMGNA_00848 Funciton: Transcriptional regulator, GntR family Locus tag: RUMGNA_00847 Name: BH0652 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: RUMGNA_00846 Name: BH0653 Funciton: ABC-type multidrug transport system, permease component
	RUMGNA_00848	RUMGNA_00848	Transcriptional regulator, GntR family
	RUMGNA_00847	BH0652	ABC-type multidrug transport system, ATPase component
	RUMGNA_00846	BH0653	ABC-type multidrug transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD