Regulog ScrR - Sphingomonadales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sucrose utilization |
| Effector: | Sucrose |
| Phylum: | Proteobacteria/alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Sphingomonadales
- By TF family - LacI
- By effector - Sucrose
- By pathway - Sucrose utilization
| Genome | Genes | Operons |
|---|---|---|
| Erythrobacter litoralis HTCC2594 | 3 | 2 |
| Erythrobacter sp. NAP1 | ||
| Novosphingobium aromaticivorans DSM 12444 | 5 | 3 |
| Sphingobium japonicum UT26S | ||
| Sphingomonas wittichii RW1 | ||
| Sphingopyxis alaskensis RB2256 | ||
| Zymomonas mobilis subsp. mobilis ZM4 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| scrT |
*
Erythrobacter litoralis HTCC2594 Site: position = -112 score = 6.08236 sequence = CAATGCAAACGATTGCAACC Site: position = -88 score = 6.10326 sequence = TTTTGCAATCGTTTGCAATC Gene: ELI_04245: Predicted sucrose transporter, MelB family |
|
*
Novosphingobium aromaticivorans DSM 12444 Site: position = -84 score = 5.26075 sequence = TTATGCAATCGATTGTTGTC Gene: Saro_1877: Predicted sucrose transporter, MelB family |
|
|
|
|
Predicted sucrose transporter, MelB family |
| COG3345 |
|
|
Gene: Saro_1878: Alpha-galactosidase (EC 3.2.1.22) |
|
|
|
|
Alpha-galactosidase (EC 3.2.1.22) |
| sacB |
Gene: ELI_04235: Levansucrase (EC 2.4.1.10) |
|
Gene: Saro_1879: Levansucrase (EC 2.4.1.10) |
|
|
|
|
Levansucrase (EC 2.4.1.10) |
| scrR |
Gene: ELI_04250: Sucrose utilization transcriptional regulator ScrR, LacI family |
|
*
Novosphingobium aromaticivorans DSM 12444 Site: position = -200 score = 5.84293 sequence = CCATACAATCGTTTGCAATG Site: position = -177 score = 5.7362 sequence = TTTAGCAATCGATTGCATCG Gene: Saro_1880: Sucrose utilization transcriptional regulator ScrR, LacI family |
|
|
|
|
Sucrose utilization transcriptional regulator ScrR, LacI family |
| CRON 2. | ||||||||
| omp(Scr) |
*
Erythrobacter litoralis HTCC2594 Site: position = -103 score = 6.10326 sequence = GATTGCAAACGATTGCAAAA Site: position = -79 score = 6.08236 sequence = GGTTGCAATCGTTTGCATTG Gene: ELI_04240: Predicted sucrose-specific TonB-dependent receptor |
|
*
Novosphingobium aromaticivorans DSM 12444 Site: position = -106 score = 5.7362 sequence = CGATGCAATCGATTGCTAAA Site: position = -83 score = 5.84293 sequence = CATTGCAAACGATTGTATGG Gene: Saro_1881: Predicted sucrose-specific TonB-dependent receptor |
|
|
|
|
Predicted sucrose-specific TonB-dependent receptor |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |