Regulon of ScrR in Novosphingobium aromaticivorans DSM 12444

Properties
Regulator type:	Transcription factor
TF locus tag:	Saro_1880
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose
Regulog:	ScrR - Sphingomonadales
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By TF family - LacI
By effector - Sucrose
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -106 Score: 5.7 Sequence: CGATGCAATCGATTGCTAAA Position: -83 Score: 5.8 Sequence: CATTGCAAACGATTGTATGG Locus tag: Saro_1881 Name: omp(Scr) Funciton: Predicted sucrose-specific TonB-dependent receptor
	Saro_1881	omp(Scr)	Predicted sucrose-specific TonB-dependent receptor
Position: -200 Score: 5.8 Sequence: CCATACAATCGTTTGCAATG Position: -177 Score: 5.7 Sequence: TTTAGCAATCGATTGCATCG Locus tag: Saro_1880 Name: scrR Funciton: Sucrose utilization transcriptional regulator ScrR, LacI family
	Saro_1880	scrR	Sucrose utilization transcriptional regulator ScrR, LacI family
Position: -84 Score: 5.3 Sequence: TTATGCAATCGATTGTTGTC Locus tag: Saro_1877 Name: scrT Funciton: Predicted sucrose transporter, MelB family Locus tag: Saro_1878 Name: COG3345 Funciton: Alpha-galactosidase (EC 3.2.1.22) Locus tag: Saro_1879 Name: sacB Funciton: Levansucrase (EC 2.4.1.10)
	Saro_1877	scrT	Predicted sucrose transporter, MelB family
	Saro_1878	COG3345	Alpha-galactosidase (EC 3.2.1.22)
	Saro_1879	sacB	Levansucrase (EC 2.4.1.10)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD