Regulon of ScrR in Erythrobacter litoralis HTCC2594

Properties
Regulator type:	Transcription factor
TF locus tag:	ELI_04250
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose
Regulog:	ScrR - Sphingomonadales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By TF family - LacI
By effector - Sucrose
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -103 Score: 6.1 Sequence: GATTGCAAACGATTGCAAAA Position: -79 Score: 6.1 Sequence: GGTTGCAATCGTTTGCATTG Locus tag: ELI_04240 Name: omp(Scr) Funciton: Predicted sucrose-specific TonB-dependent receptor
	ELI_04240	omp(Scr)	Predicted sucrose-specific TonB-dependent receptor
Position: -112 Score: 6.1 Sequence: CAATGCAAACGATTGCAACC Position: -88 Score: 6.1 Sequence: TTTTGCAATCGTTTGCAATC Locus tag: ELI_04245 Name: scrT Funciton: Predicted sucrose transporter, MelB family Locus tag: ELI_04250 Name: scrR Funciton: Sucrose utilization transcriptional regulator ScrR, LacI family
	ELI_04245	scrT	Predicted sucrose transporter, MelB family
	ELI_04250	scrR	Sucrose utilization transcriptional regulator ScrR, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD