Regulog Bpro_5109 - Comamonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Comamonadaceae
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Acidovorax avenae subsp. citrulli AAC00-1 | ||
| Acidovorax sp. JS42 | ||
| Comamonas testosteroni KF-1 | ||
| Delftia acidovorans SPH-1 | ||
| Leptothrix cholodnii SP-6 | ||
| Methylibium petroleiphilum PM1 | ||
| Polaromonas naphthalenivorans CJ2 | ||
| Polaromonas sp. JS666 | 3 | 1 |
| Rhodoferax ferrireducens DSM 15236 | ||
| Variovorax paradoxus S110 | ||
| Verminephrobacter eiseniae EF01-2 | 9 | 1 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| Bpro_5109 |
|
|
|
|
|
|
|
*
Polaromonas sp. JS666 Site: position = -80 score = 5.70558 sequence = ACGTGAATACGTATTCACAG Site: position = -26 score = 6.04472 sequence = TTATGACTACGTATTCAAAA Gene: Bpro_5109: Predicted transcriptional regulator, LacI family |
|
|
*
Verminephrobacter eiseniae EF01-2 Site: position = -34 score = 5.78684 sequence = AAATGACTACGAATACATTT Gene: Veis_4515: Predicted transcriptional regulator, LacI family |
Predicted transcriptional regulator, LacI family |
| Veis_4516 |
|
|
|
|
|
|
|
|
|
|
Gene: Veis_4516: Predicted sugar ABC transporter, substrate-binding protein |
Predicted sugar ABC transporter, substrate-binding protein |
| Veis_4517 |
|
|
|
|
|
|
|
|
|
|
Gene: Veis_4517: Predicted sugar ABC transporter, permease protein 1 |
Predicted sugar ABC transporter, permease protein 1 |
| Veis_4518 |
|
|
|
|
|
|
|
|
|
|
Gene: Veis_4518: Predicted sugar ABC transporter, permease protein 2 |
Predicted sugar ABC transporter, permease protein 2 |
| Veis_4519 |
|
|
|
|
|
|
|
|
|
|
Gene: Veis_4519: Predicted oxidoreductase |
Predicted oxidoreductase |
| Veis_4520 |
|
|
|
|
|
|
|
|
|
|
Gene: Veis_4520: Predicted dehydrogenase |
Predicted dehydrogenase |
| Veis_4521 |
|
|
|
|
|
|
|
|
|
|
Gene: Veis_4521: Predicted sugar ABC transporter, ATP-binding protein |
Predicted sugar ABC transporter, ATP-binding protein |
| Veis_4522 |
|
|
|
|
|
|
|
Gene: Bpro_5110: Putative membrane protein |
|
|
Gene: Veis_4522: Putative membrane protein |
Putative membrane protein |
| Veis_4523 |
|
|
|
|
|
Gene: Mpe_A3651: Putative dehydratase |
|
Gene: Bpro_5111: Putative dehydratase |
|
Gene: Vapar_3211: Putative dehydratase |
Gene: Veis_4523: Putative dehydratase |
Putative dehydratase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |