Regulog Bpro_5109 - Comamonadaceae

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Proteobacteria/beta
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By TF family - LacI
By pathway - Sugar utilization

Statistics of regulated genes
Genome	Genes	Operons
Acidovorax avenae subsp. citrulli AAC00-1
Acidovorax sp. JS42
Comamonas testosteroni KF-1
Delftia acidovorans SPH-1
Leptothrix cholodnii SP-6
Methylibium petroleiphilum PM1
Polaromonas naphthalenivorans CJ2
Polaromonas sp. JS666	3	1
Rhodoferax ferrireducens DSM 15236
Variovorax paradoxus S110
Verminephrobacter eiseniae EF01-2	9	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes												Function

CRON 1.
Bpro_5109	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Leptothrix cholodnii SP-6	Methylibium petroleiphilum PM1	Polaromonas naphthalenivorans CJ2	* Polaromonas sp. JS666 Site: position = -80 score = 5.70558 sequence = ACGTGAATACGTATTCACAG Site: position = -26 score = 6.04472 sequence = TTATGACTACGTATTCAAAA Gene: Bpro_5109: Predicted transcriptional regulator, LacI family	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	* Verminephrobacter eiseniae EF01-2 Site: position = -34 score = 5.78684 sequence = AAATGACTACGAATACATTT Gene: Veis_4515: Predicted transcriptional regulator, LacI family	Predicted transcriptional regulator, LacI family
Veis_4516	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Leptothrix cholodnii SP-6	Methylibium petroleiphilum PM1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2 Gene: Veis_4516: Predicted sugar ABC transporter, substrate-binding protein	Predicted sugar ABC transporter, substrate-binding protein
Veis_4517	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Leptothrix cholodnii SP-6	Methylibium petroleiphilum PM1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2 Gene: Veis_4517: Predicted sugar ABC transporter, permease protein 1	Predicted sugar ABC transporter, permease protein 1
Veis_4518	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Leptothrix cholodnii SP-6	Methylibium petroleiphilum PM1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2 Gene: Veis_4518: Predicted sugar ABC transporter, permease protein 2	Predicted sugar ABC transporter, permease protein 2
Veis_4519	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Leptothrix cholodnii SP-6	Methylibium petroleiphilum PM1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2 Gene: Veis_4519: Predicted oxidoreductase	Predicted oxidoreductase
Veis_4520	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Leptothrix cholodnii SP-6	Methylibium petroleiphilum PM1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2 Gene: Veis_4520: Predicted dehydrogenase	Predicted dehydrogenase
Veis_4521	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Leptothrix cholodnii SP-6	Methylibium petroleiphilum PM1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2 Gene: Veis_4521: Predicted sugar ABC transporter, ATP-binding protein	Predicted sugar ABC transporter, ATP-binding protein
Veis_4522	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Leptothrix cholodnii SP-6	Methylibium petroleiphilum PM1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666 Gene: Bpro_5110: Putative membrane protein	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2 Gene: Veis_4522: Putative membrane protein	Putative membrane protein
Veis_4523	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Leptothrix cholodnii SP-6	Methylibium petroleiphilum PM1 Gene: Mpe_A3651: Putative dehydratase	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666 Gene: Bpro_5111: Putative dehydratase	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110 Gene: Vapar_3211: Putative dehydratase	Verminephrobacter eiseniae EF01-2 Gene: Veis_4523: Putative dehydratase	Putative dehydratase

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog Bpro_5109 - Comamonadaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --