Regulon of Bpro_5109 in Polaromonas sp. JS666

Properties
Regulator type:	Transcription factor
TF locus tag:	Bpro_5109
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	Bpro_5109 - Comamonadaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -80 Score: 5.7 Sequence: ACGTGAATACGTATTCACAG Position: -26 Score: 6 Sequence: TTATGACTACGTATTCAAAA Locus tag: Bpro_5109 Name: Bpro_5109 Funciton: Predicted transcriptional regulator, LacI family Locus tag: Bpro_5110 Name: Veis_4522 Funciton: Putative membrane protein Locus tag: Bpro_5111 Name: Veis_4523 Funciton: Putative dehydratase
	Bpro_5109	Bpro_5109	Predicted transcriptional regulator, LacI family
	Bpro_5110	Veis_4522	Putative membrane protein
	Bpro_5111	Veis_4523	Putative dehydratase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD