Regulon of Bpro_5109 in Verminephrobacter eiseniae EF01-2

Properties
Regulator type:	Transcription factor
TF locus tag:	Veis_4515
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	Bpro_5109 - Comamonadaceae
Statistics of regulated genes:
- Genes	9
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -34 Score: 5.8 Sequence: AAATGACTACGAATACATTT Locus tag: Veis_4515 Name: Bpro_5109 Funciton: Predicted transcriptional regulator, LacI family Locus tag: Veis_4516 Name: Veis_4516 Funciton: Predicted sugar ABC transporter, substrate-binding protein Locus tag: Veis_4517 Name: Veis_4517 Funciton: Predicted sugar ABC transporter, permease protein 1 Locus tag: Veis_4518 Name: Veis_4518 Funciton: Predicted sugar ABC transporter, permease protein 2 Locus tag: Veis_4519 Name: Veis_4519 Funciton: Predicted oxidoreductase Locus tag: Veis_4520 Name: Veis_4520 Funciton: Predicted dehydrogenase Locus tag: Veis_4521 Name: Veis_4521 Funciton: Predicted sugar ABC transporter, ATP-binding protein Locus tag: Veis_4522 Name: Veis_4522 Funciton: Putative membrane protein Locus tag: Veis_4523 Name: Veis_4523 Funciton: Putative dehydratase
	Veis_4515	Bpro_5109	Predicted transcriptional regulator, LacI family
	Veis_4516	Veis_4516	Predicted sugar ABC transporter, substrate-binding protein
	Veis_4517	Veis_4517	Predicted sugar ABC transporter, permease protein 1
	Veis_4518	Veis_4518	Predicted sugar ABC transporter, permease protein 2
	Veis_4519	Veis_4519	Predicted oxidoreductase
	Veis_4520	Veis_4520	Predicted dehydrogenase
	Veis_4521	Veis_4521	Predicted sugar ABC transporter, ATP-binding protein
	Veis_4522	Veis_4522	Putative membrane protein
	Veis_4523	Veis_4523	Putative dehydratase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD