Regulog ManR - Psychromonadaceae/Aeromonadales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Mannose utilization |
| Effector: | Mannose-6-phosphate |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Psychromonadaceae/Aeromonadales
- By TF family - LacI
- By effector - Mannose-6-phosphate
- By pathway - Mannose utilization
| Genome | Genes | Operons |
|---|---|---|
| Aeromonas hydrophila subsp. hydrophila ATCC 7966 | 8 | 3 |
| Aeromonas salmonicida subsp. salmonicida A449 | ||
| Psychromonas sp. CNPT3 | ||
| Psychromonas ingrahamii 37 | ||
| Moritella sp. PE36 | ||
| Tolumonas auensis DSM 9187 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| manA1 |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -182 score = 6.5146 sequence = AAGGTATATCGATTAACCTT Site: position = -50 score = 6.28689 sequence = CAGGTTAATCGATTTATCTC Gene: AHA_2343: Mannose-6-phosphate isomerase, class I |
|
|
|
|
|
Mannose-6-phosphate isomerase, class I |
| manW |
Gene: AHA_2342: Mannose-specific PTS, IIA component (EC 2.7.1.69) |
|
|
|
|
|
Mannose-specific PTS, IIA component (EC 2.7.1.69) |
| manX |
Gene: AHA_2341: Mannose-specific PTS, IIB component (EC 2.7.1.69) |
|
|
|
|
|
Mannose-specific PTS, IIB component (EC 2.7.1.69) |
| manY |
Gene: AHA_2340: Mannose-specific PTS, IIC component (EC 2.7.1.69) |
|
|
|
|
|
Mannose-specific PTS, IIC component (EC 2.7.1.69) |
| manZ |
Gene: AHA_2339: Mannose-specific PTS, IID component (EC 2.7.1.69) |
|
|
|
|
|
Mannose-specific PTS, IID component (EC 2.7.1.69) |
| manA |
Gene: AHA_2338: Mannose-6-phosphate isomerase (EC 5.3.1.8) |
|
|
|
|
|
Mannose-6-phosphate isomerase (EC 5.3.1.8) |
| CRON 2. | |||||||
| manR |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -191 score = 6.28689 sequence = GAGATAAATCGATTAACCTG Site: position = -59 score = 6.5146 sequence = AAGGTTAATCGATATACCTT Gene: AHA_2344: Mannose utilization transcriptional regulator ManR, LacI family |
|
|
|
|
|
Mannose utilization transcriptional regulator ManR, LacI family |
| CRON 3. | |||||||
| pgiA |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -83 score = 5.74651 sequence = GTGGTTAATGGATTAACCCT Gene: AHA_2345: Glucose-6-phosphate isomerase, archaeal (EC 5.3.1.9) |
|
|
|
|
|
Glucose-6-phosphate isomerase, archaeal (EC 5.3.1.9) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |