Regulog BC0230 - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - LacI
| Genome | Genes | Operons |
|---|---|---|
| Anoxybacillus flavithermus WK1 | ||
| Bacillus amyloliquefaciens FZB42 | ||
| Bacillus cereus ATCC 14579 | 4 | 2 |
| Bacillus clausii KSM-K16 | ||
| Bacillus halodurans C-125 | ||
| Bacillus licheniformis DSM 13 | ||
| Bacillus pumilus SAFR-032 | ||
| Bacillus subtilis subsp. subtilis str. 168 | ||
| Geobacillus kaustophilus HTA426 | ||
| Oceanobacillus iheyensis HTE831 | ||
| Paenibacillus sp. JDR-2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| BC2618 |
|
|
*
Bacillus cereus ATCC 14579 Site: position = -114 score = 6.17558 sequence = ACCTGAAACGCTTTTCATAA Gene: BC2618: Predicted hydrolase (HAD superfamily) |
|
|
|
|
|
|
|
|
Predicted hydrolase (HAD superfamily) |
| CRON 2. | ||||||||||||
| BC0231 |
|
|
*
Bacillus cereus ATCC 14579 Site: position = -105 score = 6.32916 sequence = ACAGGAAACGCGTTTCATAC Gene: BC0231: Hypothetical protein |
|
|
|
|
|
|
|
|
Hypothetical protein |
| BC0232 |
|
|
Gene: BC0232: Putative membrane protein |
|
|
|
|
|
|
|
|
Putative membrane protein |
| BC0233 |
|
|
Gene: BC0233: Hypothetical protein |
|
|
|
|
|
|
|
|
Hypothetical protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |