Regulog BC0230 - Bacillales

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:
Effector:
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - LacI

Statistics of regulated genes
Genome	Genes	Operons
Anoxybacillus flavithermus WK1
Bacillus amyloliquefaciens FZB42
Bacillus cereus ATCC 14579	4	2
Bacillus clausii KSM-K16
Bacillus halodurans C-125
Bacillus licheniformis DSM 13
Bacillus pumilus SAFR-032
Bacillus subtilis subsp. subtilis str. 168
Geobacillus kaustophilus HTA426
Oceanobacillus iheyensis HTE831
Paenibacillus sp. JDR-2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes												Function

CRON 1.
BC2618	Anoxybacillus flavithermus WK1	Bacillus amyloliquefaciens FZB42	* Bacillus cereus ATCC 14579 Site: position = -114 score = 6.17558 sequence = ACCTGAAACGCTTTTCATAA Gene: BC2618: Predicted hydrolase (HAD superfamily)	Bacillus clausii KSM-K16	Bacillus halodurans C-125	Bacillus licheniformis DSM 13	Bacillus pumilus SAFR-032	Bacillus subtilis subsp. subtilis str. 168	Geobacillus kaustophilus HTA426	Oceanobacillus iheyensis HTE831	Paenibacillus sp. JDR-2	Predicted hydrolase (HAD superfamily)

CRON 2.
BC0231	Anoxybacillus flavithermus WK1	Bacillus amyloliquefaciens FZB42	* Bacillus cereus ATCC 14579 Site: position = -105 score = 6.32916 sequence = ACAGGAAACGCGTTTCATAC Gene: BC0231: Hypothetical protein	Bacillus clausii KSM-K16	Bacillus halodurans C-125	Bacillus licheniformis DSM 13	Bacillus pumilus SAFR-032	Bacillus subtilis subsp. subtilis str. 168	Geobacillus kaustophilus HTA426	Oceanobacillus iheyensis HTE831	Paenibacillus sp. JDR-2	Hypothetical protein
BC0232	Anoxybacillus flavithermus WK1	Bacillus amyloliquefaciens FZB42	Bacillus cereus ATCC 14579 Gene: BC0232: Putative membrane protein	Bacillus clausii KSM-K16	Bacillus halodurans C-125	Bacillus licheniformis DSM 13	Bacillus pumilus SAFR-032	Bacillus subtilis subsp. subtilis str. 168	Geobacillus kaustophilus HTA426	Oceanobacillus iheyensis HTE831	Paenibacillus sp. JDR-2	Putative membrane protein
BC0233	Anoxybacillus flavithermus WK1	Bacillus amyloliquefaciens FZB42	Bacillus cereus ATCC 14579 Gene: BC0233: Hypothetical protein	Bacillus clausii KSM-K16	Bacillus halodurans C-125	Bacillus licheniformis DSM 13	Bacillus pumilus SAFR-032	Bacillus subtilis subsp. subtilis str. 168	Geobacillus kaustophilus HTA426	Oceanobacillus iheyensis HTE831	Paenibacillus sp. JDR-2	Hypothetical protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog BC0230 - Bacillales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --