Regulon of BC0230 in Bacillus cereus ATCC 14579

Properties
Regulator type:	Transcription factor
TF locus tag:	BC0230
Regulator family:	LacI
Regulation mode:	repressor
Biological process:
Effector:
Regulog:	BC0230 - Bacillales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - LacI

Regulated operons
	Locus Tag	Name	Function
Position: -114 Score: 6.2 Sequence: ACCTGAAACGCTTTTCATAA Locus tag: BC2618 Name: BC2618 Funciton: Predicted hydrolase (HAD superfamily)
	BC2618	BC2618	Predicted hydrolase (HAD superfamily)
Position: -105 Score: 6.3 Sequence: ACAGGAAACGCGTTTCATAC Locus tag: BC0231 Name: BC0231 Funciton: Hypothetical protein Locus tag: BC0232 Name: BC0232 Funciton: Putative membrane protein Locus tag: BC0233 Name: BC0233 Funciton: Hypothetical protein
	BC0231	BC0231	Hypothetical protein
	BC0232	BC0232	Putative membrane protein
	BC0233	BC0233	Hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD