Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing BC0232 gene

Properties
Regulog: BC0230 - Bacillales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process:
Effector:
Phylum: Firmicutes
Built upon 2 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacillus cereus ATCC 14579
Position: -105
Score: 6.32916
Sequence: ACAGGAAACGCGTTTCATAC
Locus tag: BC0231
Name: BC0231
Funciton: Hypothetical protein
Locus tag: BC0232
Name: BC0232
Funciton: Putative membrane protein
Locus tag: BC0233
Name: BC0233
Funciton: Hypothetical protein
BC0231-BC0232-BC0233 -105 6.3 ACAGGAAACGCGTTTCATAC BC0231