Regulog Atu5239 - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By TF family - LacI
| Genome | Genes | Operons |
|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | 8 | 2 |
| Azorhizobium caulinodans ORS 571 | ||
| Bartonella quintana str. Toulouse | ||
| Bradyrhizobium japonicum USDA 110 | 8 | 1 |
| Bradyrhizobium sp. BTAi1 | ||
| Brucella melitensis 16M | ||
| Mesorhizobium loti MAFF303099 | ||
| Mesorhizobium sp. BNC1 | ||
| Nitrobacter winogradskyi Nb-255 | ||
| Rhizobium etli CFN 42 | ||
| Rhizobium leguminosarum bv. viciae 3841 | ||
| Rhizobium sp. NGR234 | ||
| Rhodopseudomonas palustris CGA009 | ||
| Sinorhizobium meliloti 1021 | ||
| Xanthobacter autotrophicus Py2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| dsd |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -64 score = 6.34682 sequence = TAATGACAACGTTACCATCA Site: position = -27 score = 6.12675 sequence = CAATGACAACGATACCATCG Gene: Atu5233: D-serine deaminase |
|
|
*
Bradyrhizobium japonicum USDA 110 Site: position = -67 score = 6.16221 sequence = TAATGACAACGTTGTCATTC Gene: bll3981: D-serine deaminase |
|
|
|
|
|
|
|
|
|
|
|
D-serine deaminase |
| Atu5234 |
Gene: Atu5234: ABC transporter, membrane spanning protein |
|
|
Gene: bll3980: ABC transporter, membrane spanning protein |
|
|
|
|
|
|
|
|
|
|
|
ABC transporter, membrane spanning protein |
| Atu5235 |
Gene: Atu5235: ABC transporter, membrane spanning protein (amino acid) |
|
|
Gene: bll3979: ABC transporter, membrane spanning protein (amino acid) |
|
|
|
|
|
|
|
|
|
|
|
ABC transporter, membrane spanning protein (amino acid) |
| Atu5236 |
Gene: Atu5236: ABC transporter ATP-binding protein |
|
|
Gene: bll3978: ABC transporter ATP-binding protein |
|
|
|
|
|
|
|
|
|
|
|
ABC transporter ATP-binding protein |
| Atu5237 |
Gene: Atu5237: ABC transporter substrate-binding protein |
|
|
Gene: bll3977: ABC transporter substrate-binding protein |
|
|
|
|
|
|
|
|
|
|
|
ABC transporter substrate-binding protein |
| COG0251 |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -88 score = 6.34682 sequence = TGATGGTAACGTTGTCATTA Site: position = -125 score = 6.12675 sequence = CGATGGTATCGTTGTCATTG Gene: Atu5232: Putative translation initiation inhibitor, yjgF family |
|
|
Gene: bll3976: Putative translation initiation inhibitor, yjgF family |
|
|
|
|
|
|
|
|
|
|
|
Putative translation initiation inhibitor, yjgF family |
| COG3608 |
Gene: Atu5238: Predicted deacylase |
|
|
Gene: bll3975: Predicted deacylase |
|
|
|
|
|
|
|
|
|
|
|
Predicted deacylase |
| Atu5239 |
Gene: Atu5239: Transcriptional regulator, LacI family |
|
|
Gene: bll3974: Transcriptional regulator, LacI family |
|
|
|
|
|
|
|
|
|
|
|
Transcriptional regulator, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |