Regulon of Atu5239 in Agrobacterium tumefaciens str. C58 (Cereon)

Properties
Regulator type:	Transcription factor
TF locus tag:	Atu5239
Regulator family:	LacI
Regulation mode:
Biological process:
Effector:
Regulog:	Atu5239 - Rhizobiales
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI

Regulated operons
	Locus Tag	Name	Function
Position: -64 Score: 6.3 Sequence: TAATGACAACGTTACCATCA Position: -27 Score: 6.1 Sequence: CAATGACAACGATACCATCG Locus tag: Atu5233 Name: dsd Funciton: D-serine deaminase Locus tag: Atu5234 Name: null Funciton: ABC transporter, membrane spanning protein Locus tag: Atu5235 Name: null Funciton: ABC transporter, membrane spanning protein (amino acid) Locus tag: Atu5236 Name: null Funciton: ABC transporter ATP-binding protein Locus tag: Atu5237 Name: null Funciton: ABC transporter substrate-binding protein Locus tag: Atu5238 Name: COG3608 Funciton: Predicted deacylase Locus tag: Atu5239 Name: Atu5239 Funciton: Transcriptional regulator, LacI family
	Atu5233	dsd	D-serine deaminase
	Atu5234		ABC transporter, membrane spanning protein
	Atu5235		ABC transporter, membrane spanning protein (amino acid)
	Atu5236		ABC transporter ATP-binding protein
	Atu5237		ABC transporter substrate-binding protein
	Atu5238	COG3608	Predicted deacylase
	Atu5239	Atu5239	Transcriptional regulator, LacI family
Position: -125 Score: 6.1 Sequence: CGATGGTATCGTTGTCATTG Position: -88 Score: 6.3 Sequence: TGATGGTAACGTTGTCATTA Locus tag: Atu5232 Name: COG0251 Funciton: Putative translation initiation inhibitor, yjgF family
	Atu5232	COG0251	Putative translation initiation inhibitor, yjgF family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD