Regulon of Atu5239 in Bradyrhizobium japonicum USDA 110

Properties
Regulator type:	Transcription factor
TF locus tag:	bll3974
Regulator family:	LacI
Regulation mode:
Biological process:
Effector:
Regulog:	Atu5239 - Rhizobiales
Statistics of regulated genes:
- Genes	8
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI

Regulated operons
	Locus Tag	Name	Function
Position: -67 Score: 6.2 Sequence: TAATGACAACGTTGTCATTC Locus tag: bll3981 Name: dsd Funciton: D-serine deaminase Locus tag: bll3980 Name: null Funciton: ABC transporter, membrane spanning protein Locus tag: bll3979 Name: null Funciton: ABC transporter, membrane spanning protein (amino acid) Locus tag: bll3978 Name: null Funciton: ABC transporter ATP-binding protein Locus tag: bll3977 Name: null Funciton: ABC transporter substrate-binding protein Locus tag: bll3976 Name: COG0251 Funciton: Putative translation initiation inhibitor, yjgF family Locus tag: bll3975 Name: COG3608 Funciton: Predicted deacylase Locus tag: bll3974 Name: Atu5239 Funciton: Transcriptional regulator, LacI family
	bll3981	dsd	D-serine deaminase
	bll3980		ABC transporter, membrane spanning protein
	bll3979		ABC transporter, membrane spanning protein (amino acid)
	bll3978		ABC transporter ATP-binding protein
	bll3977		ABC transporter substrate-binding protein
	bll3976	COG0251	Putative translation initiation inhibitor, yjgF family
	bll3975	COG3608	Predicted deacylase
	bll3974	Atu5239	Transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD