Regulog pRL90265 - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | ||
| Azorhizobium caulinodans ORS 571 | ||
| Bartonella quintana str. Toulouse | ||
| Bradyrhizobium japonicum USDA 110 | ||
| Bradyrhizobium sp. BTAi1 | ||
| Brucella melitensis 16M | ||
| Mesorhizobium loti MAFF303099 | ||
| Mesorhizobium sp. BNC1 | ||
| Nitrobacter winogradskyi Nb-255 | ||
| Rhizobium etli CFN 42 | 7 | 1 |
| Rhizobium leguminosarum bv. viciae 3841 | 7 | 1 |
| Rhizobium sp. NGR234 | ||
| Rhodopseudomonas palustris CGA009 | ||
| Sinorhizobium meliloti 1021 | 10 | 3 |
| Xanthobacter autotrophicus Py2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| PF00459 |
|
|
|
|
|
|
|
|
|
|
|
|
|
*
Sinorhizobium meliloti 1021 Site: position = -52 score = 5.94635 sequence = CGATGAACACGTGTGCAATA Site: position = -34 score = 5.63523 sequence = TATTGCGCGCGTGTGCAATG Gene: SMb20150: Inositol monophosphatase |
|
Inositol monophosphatase |
| SSF52799 |
|
|
|
|
|
|
|
|
|
|
|
|
|
Gene: SMb20151: Protein tyrosine phosphatase superfamily |
|
Protein tyrosine phosphatase superfamily |
| PF00149 |
Gene: Atu4354: Metallo-dependent phosphatase |
|
|
|
|
|
|
|
|
|
|
|
|
Gene: SMb20152: Metallo-dependent phosphatase |
|
Metallo-dependent phosphatase |
| COG1283 |
|
|
|
|
|
|
|
|
|
|
|
|
|
Gene: SMb20153: Sodium-dependent phosphate transporter |
|
Sodium-dependent phosphate transporter |
| CRON 2. | ||||||||||||||||
| pRL90270 |
|
|
|
|
|
|
|
|
|
*
Rhizobium etli CFN 42 Site: position = -152 score = 5.78568 sequence = TTTTGCACACGTGCTCAAAT Gene: RHE_PB00139: putative sugar ABC transporter, substrate-binding protein |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -152 score = 5.8725 sequence = TTTTGCACACGTGCTCAATT Gene: pRL90270: putative sugar ABC transporter, substrate-binding protein |
|
|
|
|
putative sugar ABC transporter, substrate-binding protein |
| pRL90269 |
|
|
|
|
|
|
|
|
|
Gene: RHE_PB00138: ABC transporter, membrane spanning protein (sugar) |
Gene: pRL90269: ABC transporter, membrane spanning protein (sugar) |
|
|
|
|
ABC transporter, membrane spanning protein (sugar) |
| pRL90268 |
|
|
|
|
|
|
|
|
|
Gene: RHE_PB00137: ABC transporter, membrane spanning protein (sugars) |
Gene: pRL90268: ABC transporter, membrane spanning protein (sugars) |
|
|
|
|
ABC transporter, membrane spanning protein (sugars) |
| pRL90267 |
|
|
|
|
|
|
|
|
|
Gene: RHE_PB00136: ABC transporter, nucleotide binding/ATPase protein (sugar) |
Gene: pRL90267: ABC transporter, nucleotide binding/ATPase protein (sugar) |
|
|
|
|
ABC transporter, nucleotide binding/ATPase protein (sugar) |
| COG0584 |
|
|
|
|
|
|
|
|
|
Gene: RHE_PB00135: Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46) |
Gene: pRL90266: Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46) |
|
|
|
|
Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46) |
| pRL90265 |
|
|
|
|
|
|
|
|
|
Gene: RHE_PB00134: Transcriptional regulator, LacI family |
Gene: pRL90265: Transcriptional regulator, LacI family |
|
|
*
Sinorhizobium meliloti 1021 Site: position = -232 score = 5.7191 sequence = AAATGCACACGTGAGCAATC Site: position = -180 score = 5.49979 sequence = ATACGCACACGTGTTCAGTT Gene: SMb20154: Transcriptional regulator, LacI family |
|
Transcriptional regulator, LacI family |
| PF00459 |
|
|
|
|
|
|
|
|
|
Gene: RHE_PB00133: Inositol monophosphatase |
Gene: pRL90264: Inositol monophosphatase |
|
|
Gene: SMb20159: Inositol monophosphatase |
|
Inositol monophosphatase |
| SMb20155 |
|
|
|
|
|
|
|
|
|
|
|
|
|
*
Sinorhizobium meliloti 1021 Site: position = -298 score = 5.7191 sequence = GATTGCTCACGTGTGCATTT Site: position = -350 score = 5.49979 sequence = AACTGAACACGTGTGCGTAT Gene: SMb20155: putative ABC transporter permease protein |
|
putative ABC transporter permease protein |
| SMb20156 |
|
|
|
|
|
|
|
|
|
|
|
|
|
Gene: SMb20156: putative ABC transporter ATP-binding protein |
|
putative ABC transporter ATP-binding protein |
| SMb20158 |
|
|
|
|
|
|
|
|
|
|
|
|
|
2
Sinorhizobium meliloti 1021 Gene: SMb20158: hypothetical ABC transporter periplasmic solute-binding protein Gene: SMb20157: hypothetical ABC transporter periplasmic solute-binding protein |
|
hypothetical ABC transporter periplasmic solute-binding protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |