Regulon of pRL90265 in Rhizobium leguminosarum bv. viciae 3841

Properties
Regulator type:	Transcription factor
TF locus tag:	pRL90265
Regulator family:	LacI
Regulation mode:
Biological process:	Sugar utilization
Effector:
Regulog:	pRL90265 - Rhizobiales
Statistics of regulated genes:
- Genes	7
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -152 Score: 5.9 Sequence: TTTTGCACACGTGCTCAATT Locus tag: pRL90270 Name: pRL90270 Funciton: putative sugar ABC transporter, substrate-binding protein Locus tag: pRL90269 Name: pRL90269 Funciton: ABC transporter, membrane spanning protein (sugar) Locus tag: pRL90268 Name: pRL90268 Funciton: ABC transporter, membrane spanning protein (sugars) Locus tag: pRL90267 Name: pRL90267 Funciton: ABC transporter, nucleotide binding/ATPase protein (sugar) Locus tag: pRL90266 Name: COG0584 Funciton: Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46) Locus tag: pRL90265 Name: pRL90265 Funciton: Transcriptional regulator, LacI family Locus tag: pRL90264 Name: PF00459 Funciton: Inositol monophosphatase
	pRL90270	pRL90270	putative sugar ABC transporter, substrate-binding protein
	pRL90269	pRL90269	ABC transporter, membrane spanning protein (sugar)
	pRL90268	pRL90268	ABC transporter, membrane spanning protein (sugars)
	pRL90267	pRL90267	ABC transporter, nucleotide binding/ATPase protein (sugar)
	pRL90266	COG0584	Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46)
	pRL90265	pRL90265	Transcriptional regulator, LacI family
	pRL90264	PF00459	Inositol monophosphatase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD