Regulon of pRL90265 in Sinorhizobium meliloti 1021

Properties
Regulator type:	Transcription factor
TF locus tag:	SMb20154
Regulator family:	LacI
Regulation mode:
Biological process:	Sugar utilization
Effector:
Regulog:	pRL90265 - Rhizobiales
Statistics of regulated genes:
- Genes	10
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -350 Score: 5.5 Sequence: AACTGAACACGTGTGCGTAT Position: -298 Score: 5.7 Sequence: GATTGCTCACGTGTGCATTT Locus tag: SMb20155 Name: SMb20155 Funciton: putative ABC transporter permease protein Locus tag: SMb20156 Name: SMb20156 Funciton: putative ABC transporter ATP-binding protein Locus tag: SMb20157 Name: SMb20158 Funciton: hypothetical ABC transporter periplasmic solute-binding protein Locus tag: SMb20158 Name: SMb20158 Funciton: hypothetical ABC transporter periplasmic solute-binding protein Locus tag: SMb20159 Name: PF00459 Funciton: Inositol monophosphatase
	SMb20155	SMb20155	putative ABC transporter permease protein
	SMb20156	SMb20156	putative ABC transporter ATP-binding protein
	SMb20157	SMb20158	hypothetical ABC transporter periplasmic solute-binding protein
	SMb20158	SMb20158	hypothetical ABC transporter periplasmic solute-binding protein
	SMb20159	PF00459	Inositol monophosphatase
Position: -232 Score: 5.7 Sequence: AAATGCACACGTGAGCAATC Position: -180 Score: 5.5 Sequence: ATACGCACACGTGTTCAGTT Locus tag: SMb20154 Name: pRL90265 Funciton: Transcriptional regulator, LacI family
	SMb20154	pRL90265	Transcriptional regulator, LacI family
Position: -52 Score: 5.9 Sequence: CGATGAACACGTGTGCAATA Position: -34 Score: 5.6 Sequence: TATTGCGCGCGTGTGCAATG Locus tag: SMb20150 Name: PF00459 Funciton: Inositol monophosphatase Locus tag: SMb20151 Name: SSF52799 Funciton: Protein tyrosine phosphatase superfamily Locus tag: SMb20152 Name: PF00149 Funciton: Metallo-dependent phosphatase Locus tag: SMb20153 Name: COG1283 Funciton: Sodium-dependent phosphate transporter
	SMb20150	PF00459	Inositol monophosphatase
	SMb20151	SSF52799	Protein tyrosine phosphatase superfamily
	SMb20152	PF00149	Metallo-dependent phosphatase
	SMb20153	COG1283	Sodium-dependent phosphate transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD