Regulog IolR - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Inositol utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By TF family - LacI
- By pathway - Inositol utilization
| Genome | Genes | Operons |
|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | ||
| Azorhizobium caulinodans ORS 571 | ||
| Bartonella quintana str. Toulouse | ||
| Bradyrhizobium japonicum USDA 110 | ||
| Bradyrhizobium sp. BTAi1 | ||
| Brucella melitensis 16M | ||
| Mesorhizobium loti MAFF303099 | 8 | 2 |
| Mesorhizobium sp. BNC1 | ||
| Nitrobacter winogradskyi Nb-255 | ||
| Rhizobium etli CFN 42 | 7 | 2 |
| Rhizobium leguminosarum bv. viciae 3841 | ||
| Rhizobium sp. NGR234 | ||
| Rhodopseudomonas palustris CGA009 | ||
| Sinorhizobium meliloti 1021 | ||
| Xanthobacter autotrophicus Py2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| iolR |
|
|
|
|
|
|
*
Mesorhizobium loti MAFF303099 Site: position = -132 score = 6.01253 sequence = GAATGCTACCGGGTGCAAAA Site: position = -110 score = 6.459 sequence = GTTTGCTACCGGGTGCAAAC Gene: mlr1005: Transcriptional regulator of inositol utilization, LacI family |
|
|
*
Rhizobium etli CFN 42 Site: position = -114 score = 6.459 sequence = GTTTGCTACCGGGTGCAAAC Site: position = -135 score = 6.28563 sequence = GATTGCTACCGGGTGCAAAA Gene: RHE_CH02362: Transcriptional regulator of inositol utilization, LacI family |
|
|
|
|
|
Transcriptional regulator of inositol utilization, LacI family |
| iolE |
|
|
|
|
|
|
Gene: mlr1006: myo-inositol catabolism protein |
|
|
|
|
|
|
|
|
myo-inositol catabolism protein |
| CRON 2. | ||||||||||||||||
| iolK |
|
|
|
|
|
|
*
Mesorhizobium loti MAFF303099 Site: position = -88 score = 6.459 sequence = GTTTGCACCCGGTAGCAAAC Site: position = -66 score = 6.01253 sequence = TTTTGCACCCGGTAGCATTC Gene: mll1004: Sugar ABC transporter, substrate-binding protein |
|
|
*
Rhizobium etli CFN 42 Site: position = -84 score = 6.459 sequence = GTTTGCACCCGGTAGCAAAC Site: position = -63 score = 6.28563 sequence = TTTTGCACCCGGTAGCAATC Gene: RHE_CH02361: Sugar ABC transporter, substrate-binding protein |
|
|
|
|
|
Sugar ABC transporter, substrate-binding protein |
| iolL |
|
|
|
|
|
|
Gene: mll1003: Sugar ABC transporter, inner membrane protein |
|
|
Gene: RHE_CH02360: Sugar ABC transporter, inner membrane protein |
|
|
|
|
|
Sugar ABC transporter, inner membrane protein |
| iolM |
|
|
|
|
|
|
Gene: mll1002: Sugar ABC transporter, ATP-binding protein |
|
|
Gene: RHE_CH02359: Sugar ABC transporter, ATP-binding protein |
|
|
|
|
|
Sugar ABC transporter, ATP-binding protein |
| hyi |
|
|
|
|
|
|
Gene: mll1001: Putative hydroxypyruvate isomerase |
|
|
Gene: RHE_CH02358: Putative hydroxypyruvate isomerase |
|
|
|
|
|
Putative hydroxypyruvate isomerase |
| iolG |
|
|
|
|
|
|
Gene: mll1000: Probable myo-inositol 2-dehydrogenase EC=1.1.1.18 |
|
|
Gene: RHE_CH02357: Probable myo-inositol 2-dehydrogenase EC=1.1.1.18 |
|
|
|
|
|
Probable myo-inositol 2-dehydrogenase EC=1.1.1.18 |
| msl0999 |
|
|
|
|
|
|
Gene: msl0999: hypothetical protein |
|
|
Gene: RHE_CH02356: hypothetical protein |
|
|
|
|
|
hypothetical protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |