Regulon of IolR in Rhizobium etli CFN 42

Properties
Regulator type:	Transcription factor
TF locus tag:	RHE_CH02362
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Inositol utilization
Effector:
Regulog:	IolR - Rhizobiales
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Inositol utilization

Regulated operons
	Locus Tag	Name	Function
Position: -84 Score: 6.5 Sequence: GTTTGCACCCGGTAGCAAAC Position: -63 Score: 6.3 Sequence: TTTTGCACCCGGTAGCAATC Locus tag: RHE_CH02361 Name: iolK Funciton: Sugar ABC transporter, substrate-binding protein Locus tag: RHE_CH02360 Name: iolL Funciton: Sugar ABC transporter, inner membrane protein Locus tag: RHE_CH02359 Name: iolM Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: RHE_CH02358 Name: hyi Funciton: Putative hydroxypyruvate isomerase Locus tag: RHE_CH02357 Name: iolG Funciton: Probable myo-inositol 2-dehydrogenase EC=1.1.1.18 Locus tag: RHE_CH02356 Name: null Funciton: hypothetical protein
	RHE_CH02361	iolK	Sugar ABC transporter, substrate-binding protein
	RHE_CH02360	iolL	Sugar ABC transporter, inner membrane protein
	RHE_CH02359	iolM	Sugar ABC transporter, ATP-binding protein
	RHE_CH02358	hyi	Putative hydroxypyruvate isomerase
	RHE_CH02357	iolG	Probable myo-inositol 2-dehydrogenase EC=1.1.1.18
	RHE_CH02356		hypothetical protein
Position: -135 Score: 6.3 Sequence: GATTGCTACCGGGTGCAAAA Position: -114 Score: 6.5 Sequence: GTTTGCTACCGGGTGCAAAC Locus tag: RHE_CH02362 Name: iolR Funciton: Transcriptional regulator of inositol utilization, LacI family
	RHE_CH02362	iolR	Transcriptional regulator of inositol utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD