Regulon of IolR in Mesorhizobium loti MAFF303099

Properties
Regulator type:	Transcription factor
TF locus tag:	mlr1005
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Inositol utilization
Effector:
Regulog:	IolR - Rhizobiales
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Inositol utilization

Regulated operons
	Locus Tag	Name	Function
Position: -88 Score: 6.5 Sequence: GTTTGCACCCGGTAGCAAAC Position: -66 Score: 6 Sequence: TTTTGCACCCGGTAGCATTC Locus tag: mll1004 Name: iolK Funciton: Sugar ABC transporter, substrate-binding protein Locus tag: mll1003 Name: iolL Funciton: Sugar ABC transporter, inner membrane protein Locus tag: mll1002 Name: iolM Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: mll1001 Name: hyi Funciton: Putative hydroxypyruvate isomerase Locus tag: mll1000 Name: iolG Funciton: Probable myo-inositol 2-dehydrogenase EC=1.1.1.18 Locus tag: msl0999 Name: null Funciton: hypothetical protein
	mll1004	iolK	Sugar ABC transporter, substrate-binding protein
	mll1003	iolL	Sugar ABC transporter, inner membrane protein
	mll1002	iolM	Sugar ABC transporter, ATP-binding protein
	mll1001	hyi	Putative hydroxypyruvate isomerase
	mll1000	iolG	Probable myo-inositol 2-dehydrogenase EC=1.1.1.18
	msl0999		hypothetical protein
Position: -132 Score: 6 Sequence: GAATGCTACCGGGTGCAAAA Position: -110 Score: 6.5 Sequence: GTTTGCTACCGGGTGCAAAC Locus tag: mlr1005 Name: iolR Funciton: Transcriptional regulator of inositol utilization, LacI family Locus tag: mlr1006 Name: iolE Funciton: myo-inositol catabolism protein
	mlr1005	iolR	Transcriptional regulator of inositol utilization, LacI family
	mlr1006	iolE	myo-inositol catabolism protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD